EMAIL THIS PAGE TO A FRIEND

SLC25A31

solute carrier family 25 (mitochondrial carrier; adenine nucleotide translocator), member 31

56 Gene Product Result for
Synonyms: AAC4 ANT4 SFEC35kDa
UniProtKB ID: Q9H0C2
Gene ID:
Human(83447) Summary: Mitochondrial ADP/ATP carriers, such as SLC25A31, are nuclear-coded mitochondrial proteins that catalyze the exchange of ATP generated in mitochondria by ATP synthase (see MIM 108729) against ADP produced in cytosol by most energy-consuming reactions (Dolce et al., 2005 [PubMed 15670820]
Mouse(73333) solute carrier family 25 (mitochondrial carrier; adenine nucleotide translocator), member 31
Rat(689108) solute carrier family 25 (mitochondrial carrier; adenine nucleotide translocator), member 31
dog(483832) solute carrier family 25 (mitochondrial carrier; adenine nucleotide translocator), member 31
domestic cat(101086294) solute carrier family 25 (mitochondrial carrier; adenine nucleotide translocator), member 31
naked mole-rat(101698774) solute carrier family 25 (mitochondrial carrier; adenine nucleotide translocator), member 31
domestic guinea pig(100722295) solute carrier family 25 (mitochondrial carrier; adenine nucleotide translocator), member 31
cow(541168) solute carrier family 25 (mitochondrial carrier; adenine nucleotide translocator), member 31
sheep(101122465) solute carrier family 25 (mitochondrial carrier; adenine nucleotide translocator), member 31
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_031291 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_031291 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_031291 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_178386 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178386 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178386 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_031291 Rosetta Predictions human pricing
XM_001069558 Rosetta Predictions rat pricing
NM_178386 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031291 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00025195 predicted 833
2 SASI_Hs01_00025196 predicted 1068
3 SASI_Hs02_00358723 predicted 899
4 SASI_Hs01_00025197 predicted 534
5 SASI_Hs01_00025198 predicted 373
6 SASI_Hs02_00358724 predicted 690
7 SASI_Hs01_00025200 predicted 572
8 SASI_Hs01_00025201 predicted 444
9 SASI_Hs01_00025202 predicted 382
10 SASI_Hs02_00358725 predicted 917
11 SASI_Hs01_00025194 predicted 818
12 SASI_Hs01_00025199 predicted 847
13 SASI_Hs01_00025203 predicted 860
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001069558 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00328452 predicted 1221
2 SASI_Rn02_00328453 predicted 1108
3 SASI_Rn02_00328454 predicted 1106
4 SASI_Rn02_00328455 predicted 1150
5 SASI_Rn02_00328456 predicted 1216
6 SASI_Rn02_00328457 predicted 1184
7 SASI_Rn02_00328458 predicted 1071
8 SASI_Rn02_00328459 predicted 1213
9 SASI_Rn02_00328460 predicted 1203
10 SASI_Rn02_00328461 predicted 1074
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178386 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00098711 predicted 748
2 SASI_Mm01_00098712 predicted 604
3 SASI_Mm02_00348794 predicted 656
4 SASI_Mm01_00098713 predicted 848
5 SASI_Mm01_00098714 predicted 766
6 SASI_Mm01_00098715 predicted 589
7 SASI_Mm01_00098716 predicted 466
8 SASI_Mm01_00098717 predicted 480
9 SASI_Mm01_00098718 predicted 750
10 SASI_Mm02_00348795 predicted 831
11 SASI_Mm01_00098710 predicted 664
12 SASI_Mm01_00098719 predicted 400
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031291
SLC25A31 MISSION shRNA Bacterial Glycerol Stock
solute carrier family 25 (mitochondrial carrier; adenine nucleotide translocator), member 31
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000152149    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031291.1-410s1c1
Sequence:CCGGCCAACACAAGCTCTAAACTTTCTCGAGAAAGTTTAGAGCTTGTGTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154615    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031291.1-674s1c1
Sequence:CCGGGCTGGTTTATACCAAGGGTTTCTCGAGAAACCCTTGGTATAAACCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155954    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031291.1-377s1c1
Sequence:CCGGCGTGGCAATTTGGCAAATGTTCTCGAGAACATTTGCCAAATTGCCACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151953    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031291.1-1261s1c1
Sequence:CCGGCCACTTAGACTCAAACACATTCTCGAGAATGTGTTTGAGTCTAAGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157262    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031291.1-576s1c1
Sequence:CCGGGAACCCGATTAGGTGTCGATACTCGAGTATCGACACCTAATCGGGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156589    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031291.1-376s1c1
Sequence:CCGGGCGTGGCAATTTGGCAAATGTCTCGAGACATTTGCCAAATTGCCACGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155129    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031291.1-1260s1c1
Sequence:CCGGCCCACTTAGACTCAAACACATCTCGAGATGTGTTTGAGTCTAAGTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155980    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031291.1-452s1c1
Sequence:CCGGCAGCTATTCATGTCTGGAGTTCTCGAGAACTCCAGACATGAATAGCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031291
SLC25A31 MISSION shRNA shRNA Plasmid DNA
solute carrier family 25 (mitochondrial carrier; adenine nucleotide translocator), member 31
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000152149    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031291.1-410s1c1
Sequence:CCGGCCAACACAAGCTCTAAACTTTCTCGAGAAAGTTTAGAGCTTGTGTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154615    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031291.1-674s1c1
Sequence:CCGGGCTGGTTTATACCAAGGGTTTCTCGAGAAACCCTTGGTATAAACCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155954    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031291.1-377s1c1
Sequence:CCGGCGTGGCAATTTGGCAAATGTTCTCGAGAACATTTGCCAAATTGCCACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151953    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031291.1-1261s1c1
Sequence:CCGGCCACTTAGACTCAAACACATTCTCGAGAATGTGTTTGAGTCTAAGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157262    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031291.1-576s1c1
Sequence:CCGGGAACCCGATTAGGTGTCGATACTCGAGTATCGACACCTAATCGGGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156589    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031291.1-376s1c1
Sequence:CCGGGCGTGGCAATTTGGCAAATGTCTCGAGACATTTGCCAAATTGCCACGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155129    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031291.1-1260s1c1
Sequence:CCGGCCCACTTAGACTCAAACACATCTCGAGATGTGTTTGAGTCTAAGTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155980    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031291.1-452s1c1
Sequence:CCGGCAGCTATTCATGTCTGGAGTTCTCGAGAACTCCAGACATGAATAGCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031291
SLC25A31 MISSION shRNA Lentiviral Transduction Particles
solute carrier family 25 (mitochondrial carrier; adenine nucleotide translocator), member 31
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000152149    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031291.1-410s1c1
Sequence:CCGGCCAACACAAGCTCTAAACTTTCTCGAGAAAGTTTAGAGCTTGTGTTGGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000154615    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031291.1-674s1c1
Sequence:CCGGGCTGGTTTATACCAAGGGTTTCTCGAGAAACCCTTGGTATAAACCAGCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000155954    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031291.1-377s1c1
Sequence:CCGGCGTGGCAATTTGGCAAATGTTCTCGAGAACATTTGCCAAATTGCCACGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000151953    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031291.1-1261s1c1
Sequence:CCGGCCACTTAGACTCAAACACATTCTCGAGAATGTGTTTGAGTCTAAGTGGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000157262    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031291.1-576s1c1
Sequence:CCGGGAACCCGATTAGGTGTCGATACTCGAGTATCGACACCTAATCGGGTTCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000156589    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031291.1-376s1c1
Sequence:CCGGGCGTGGCAATTTGGCAAATGTCTCGAGACATTTGCCAAATTGCCACGCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000155129    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031291.1-1260s1c1
Sequence:CCGGCCCACTTAGACTCAAACACATCTCGAGATGTGTTTGAGTCTAAGTGGGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000155980    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031291.1-452s1c1
Sequence:CCGGCAGCTATTCATGTCTGGAGTTCTCGAGAACTCCAGACATGAATAGCTGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178386
SLC25A31 MISSION shRNA Bacterial Glycerol Stock
solute carrier family 25 (mitochondrial carrier; adenine nucleotide translocator), member 31
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000110843    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178386.2-756s1c1
Sequence:CCGGCGTGACTACCTGTTCTGGAATCTCGAGATTCCAGAACAGGTAGTCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178386.2-838s1c1
Sequence:CCGGCGGCAATATAAAGGAACCATACTCGAGTATGGTTCCTTTATATTGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110844    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178386.2-748s1c1
Sequence:CCGGGCTCAAATCGTGACTACCTGTCTCGAGACAGGTAGTCACGATTTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110840    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178386.2-1273s1c1
Sequence:CCGGCTTGTGATGAACACCATATAACTCGAGTTATATGGTGTTCATCACAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178386.2-782s1c1
Sequence:CCGGCCTATCCCTTTGACACAGTTACTCGAGTAACTGTGTCAAAGGGATAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438232    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178386.3-746s21c1
Sequence:CCGGGACACCGTTAAGGGCTTATTGCTCGAGCAATAAGCCCTTAACGGTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420962    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178386.3-1066s21c1
Sequence:CCGGTAGTTCATCAGGAGATTAAATCTCGAGATTTAATCTCCTGATGAACTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419404    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178386.3-1460s21c1
Sequence:CCGGGACTTAGTGACACTATCAAACCTCGAGGTTTGATAGTGTCACTAAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417905    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178386.3-1515s21c1
Sequence:CCGGGTTTAGTCTTGCTAGTGTATACTCGAGTATACACTAGCAAGACTAAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178386
SLC25A31 MISSION shRNA shRNA Plasmid DNA
solute carrier family 25 (mitochondrial carrier; adenine nucleotide translocator), member 31
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000110843    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178386.2-756s1c1
Sequence:CCGGCGTGACTACCTGTTCTGGAATCTCGAGATTCCAGAACAGGTAGTCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000110841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178386.2-838s1c1
Sequence:CCGGCGGCAATATAAAGGAACCATACTCGAGTATGGTTCCTTTATATTGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000110844    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178386.2-748s1c1
Sequence:CCGGGCTCAAATCGTGACTACCTGTCTCGAGACAGGTAGTCACGATTTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000110840    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178386.2-1273s1c1
Sequence:CCGGCTTGTGATGAACACCATATAACTCGAGTTATATGGTGTTCATCACAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000110842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178386.2-782s1c1
Sequence:CCGGCCTATCCCTTTGACACAGTTACTCGAGTAACTGTGTCAAAGGGATAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000438232    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178386.3-746s21c1
Sequence:CCGGGACACCGTTAAGGGCTTATTGCTCGAGCAATAAGCCCTTAACGGTGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420962    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178386.3-1066s21c1
Sequence:CCGGTAGTTCATCAGGAGATTAAATCTCGAGATTTAATCTCCTGATGAACTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419404    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178386.3-1460s21c1
Sequence:CCGGGACTTAGTGACACTATCAAACCTCGAGGTTTGATAGTGTCACTAAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417905    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178386.3-1515s21c1
Sequence:CCGGGTTTAGTCTTGCTAGTGTATACTCGAGTATACACTAGCAAGACTAAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178386
SLC25A31 MISSION shRNA Lentiviral Transduction Particles
solute carrier family 25 (mitochondrial carrier; adenine nucleotide translocator), member 31
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000110843    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178386.2-756s1c1
Sequence:CCGGCGTGACTACCTGTTCTGGAATCTCGAGATTCCAGAACAGGTAGTCACGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000110841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178386.2-838s1c1
Sequence:CCGGCGGCAATATAAAGGAACCATACTCGAGTATGGTTCCTTTATATTGCCGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000110844    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178386.2-748s1c1
Sequence:CCGGGCTCAAATCGTGACTACCTGTCTCGAGACAGGTAGTCACGATTTGAGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000110840    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178386.2-1273s1c1
Sequence:CCGGCTTGTGATGAACACCATATAACTCGAGTTATATGGTGTTCATCACAAGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000110842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178386.2-782s1c1
Sequence:CCGGCCTATCCCTTTGACACAGTTACTCGAGTAACTGTGTCAAAGGGATAGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000438232    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178386.3-746s21c1
Sequence:CCGGGACACCGTTAAGGGCTTATTGCTCGAGCAATAAGCCCTTAACGGTGTCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000420962    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178386.3-1066s21c1
Sequence:CCGGTAGTTCATCAGGAGATTAAATCTCGAGATTTAATCTCCTGATGAACTATTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000419404    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178386.3-1460s21c1
Sequence:CCGGGACTTAGTGACACTATCAAACCTCGAGGTTTGATAGTGTCACTAAGTCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000417905    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178386.3-1515s21c1
Sequence:CCGGGTTTAGTCTTGCTAGTGTATACTCGAGTATACACTAGCAAGACTAAACTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???