EMAIL THIS PAGE TO A FRIEND

SLC25A35

solute carrier family 25, member 35

164 Gene Product Result for
UniProtKB ID: Q3KQZ1, Q494X5, Q6RGS3, Q8N7Y5
Gene ID:
Human(399512) Summary: SLC25A35 belongs to the SLC25 family of mitochondrial carrier proteins (Haitina et al., 2006 [PubMed 16949250]
Mouse(71998) solute carrier family 25, member 35
Rat(497933) solute carrier family 25, member 35
Zebrafish(557185) solute carrier family 25, member 35
domestic cat(101080839) solute carrier family 25, member 35
dog(489491) solute carrier family 25, member 35
naked mole-rat(101714923) solute carrier family 25, member 35
domestic guinea pig(100730332) solute carrier family 25, member 35
cow(527669) solute carrier family 25, member 35
sheep(101107368) solute carrier family 25, member 35
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_028048 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028048 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028048 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_201520 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_201520 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_201520 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU015811 MISSION® esiRNA esiRNA targeting human SLC25A35 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_201520 Rosetta Predictions human pricing
NM_001109033 Rosetta Predictions rat pricing
NM_028048 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_201520 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00372996 predicted 863
2 SASI_Hs02_00372997 predicted 1216
3 SASI_Hs01_00189188 predicted 497
4 SASI_Hs01_00189190 predicted 794
5 SASI_Hs01_00189191 predicted 740
6 SASI_Hs01_00189192 predicted 500
7 SASI_Hs01_00189193 predicted 828
8 SASI_Hs01_00189194 predicted 1374
9 SASI_Hs01_00189195 predicted 979
10 SASI_Hs01_00189196 predicted 480
11 SASI_Hs01_00189189 predicted 285
12 SASI_Hs01_00189197 predicted 1264
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109033 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00244514 predicted 967
2 SASI_Rn02_00244515 predicted 1450
3 SASI_Rn02_00244516 predicted 855
4 SASI_Rn02_00244517 predicted 1253
5 SASI_Rn02_00244518 predicted 1420
6 SASI_Rn02_00244519 predicted 466
7 SASI_Rn02_00244520 predicted 851
8 SASI_Rn02_00244521 predicted 748
9 SASI_Rn02_00244522 predicted 511
10 SASI_Rn02_00244523 predicted 1287
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028048 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00179271 predicted 1207
2 SASI_Mm01_00179272 predicted 985
3 SASI_Mm01_00179273 predicted 654
4 SASI_Mm01_00179274 predicted 528
5 SASI_Mm01_00179275 predicted 964
6 SASI_Mm01_00179276 predicted 878
7 SASI_Mm01_00179277 predicted 979
8 SASI_Mm01_00179278 predicted 1432
9 SASI_Mm01_00179279 predicted 729
10 SASI_Mm02_00333222 predicted 1193
11 SASI_Mm01_00179280 predicted 1497
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028048
VALIDATED
SLC25A35 MISSION shRNA Bacterial Glycerol Stock
solute carrier family 25, member 35
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000114281    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_028048.1-1509s1c1
Sequence:CCGGGCTGACAGATTGACCTCTCAACTCGAGTTGAGAGGTCAATCTGTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028048.1-1371s1c1
Sequence:CCGGCCACACTATTCTCTCCCTCTTCTCGAGAAGAGGGAGAGAATAGTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114284    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_028048.1-1095s1c1
Sequence:CCGGCTCATCTATCAAGGACCTCTTCTCGAGAAGAGGTCCTTGATAGATGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114285    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_028048.1-1086s1c1
Sequence:CCGGGTGCACCTTCTCATCTATCAACTCGAGTTGATAGATGAGAAGGTGCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114283    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_028048.1-750s1c1
Sequence:CCGGCCAGTTCTTGATGAATGGCATCTCGAGATGCCATTCATCAAGAACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028048
VALIDATED
SLC25A35 MISSION shRNA shRNA Plasmid DNA
solute carrier family 25, member 35
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000114281    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_028048.1-1509s1c1
Sequence:CCGGGCTGACAGATTGACCTCTCAACTCGAGTTGAGAGGTCAATCTGTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000114282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028048.1-1371s1c1
Sequence:CCGGCCACACTATTCTCTCCCTCTTCTCGAGAAGAGGGAGAGAATAGTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000114284    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_028048.1-1095s1c1
Sequence:CCGGCTCATCTATCAAGGACCTCTTCTCGAGAAGAGGTCCTTGATAGATGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000114285    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_028048.1-1086s1c1
Sequence:CCGGGTGCACCTTCTCATCTATCAACTCGAGTTGATAGATGAGAAGGTGCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000114283    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_028048.1-750s1c1
Sequence:CCGGCCAGTTCTTGATGAATGGCATCTCGAGATGCCATTCATCAAGAACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028048
VALIDATED
SLC25A35 MISSION shRNA Lentiviral Transduction Particles
solute carrier family 25, member 35
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000114281    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_028048.1-1509s1c1
Sequence:CCGGGCTGACAGATTGACCTCTCAACTCGAGTTGAGAGGTCAATCTGTCAGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000114282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028048.1-1371s1c1
Sequence:CCGGCCACACTATTCTCTCCCTCTTCTCGAGAAGAGGGAGAGAATAGTGTGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000114284    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_028048.1-1095s1c1
Sequence:CCGGCTCATCTATCAAGGACCTCTTCTCGAGAAGAGGTCCTTGATAGATGAGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000114285    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_028048.1-1086s1c1
Sequence:CCGGGTGCACCTTCTCATCTATCAACTCGAGTTGATAGATGAGAAGGTGCACTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000114283    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_028048.1-750s1c1
Sequence:CCGGCCAGTTCTTGATGAATGGCATCTCGAGATGCCATTCATCAAGAACTGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_201520
SLC25A35 MISSION shRNA Bacterial Glycerol Stock
solute carrier family 25, member 35
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000164320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201520.1-174s1c1
Sequence:CCGGCCGAAATGTCTTCCATGCCTTCTCGAGAAGGCATGGAAGACATTTCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201520.1-409s1c1
Sequence:CCGGCCCATCTACATGGTGAAGACACTCGAGTGTCTTCACCATGTAGATGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163634    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_201520.1-2351s1c1
Sequence:CCGGGCTCCCTAAGTGCTGGAATTACTCGAGTAATTCCAGCACTTAGGGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159585    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_201520.1-2082s1c1
Sequence:CCGGCCTCTTGATTGATTGATTGATCTCGAGATCAATCAATCAATCAAGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164291    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201520.1-784s1c1
Sequence:CCGGCCCAAGTTCTCAGCAACATCACTCGAGTGATGTTGCTGAGAACTTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201520.1-474s1c1
Sequence:CCGGGTATAAGCATCAGGGCATGTTCTCGAGAACATGCCCTGATGCTTATACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162233    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201520.1-169s1c1
Sequence:CCGGCACTACCGAAATGTCTTCCATCTCGAGATGGAAGACATTTCGGTAGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164267    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201520.1-450s1c1
Sequence:CCGGCTCAGAAATTGCTGTAGGGCACTCGAGTGCCCTACAGCAATTTCTGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201520.1-785s1c1
Sequence:CCGGCCAAGTTCTCAGCAACATCATCTCGAGATGATGTTGCTGAGAACTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201520.1-687s1c1
Sequence:CCGGGAGTGGCATTGCAGTTGTCTTCTCGAGAAGACAACTGCAATGCCACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_201520
SLC25A35 MISSION shRNA shRNA Plasmid DNA
solute carrier family 25, member 35
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000164320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201520.1-174s1c1
Sequence:CCGGCCGAAATGTCTTCCATGCCTTCTCGAGAAGGCATGGAAGACATTTCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201520.1-409s1c1
Sequence:CCGGCCCATCTACATGGTGAAGACACTCGAGTGTCTTCACCATGTAGATGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163634    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_201520.1-2351s1c1
Sequence:CCGGGCTCCCTAAGTGCTGGAATTACTCGAGTAATTCCAGCACTTAGGGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159585    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_201520.1-2082s1c1
Sequence:CCGGCCTCTTGATTGATTGATTGATCTCGAGATCAATCAATCAATCAAGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164291    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201520.1-784s1c1
Sequence:CCGGCCCAAGTTCTCAGCAACATCACTCGAGTGATGTTGCTGAGAACTTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201520.1-474s1c1
Sequence:CCGGGTATAAGCATCAGGGCATGTTCTCGAGAACATGCCCTGATGCTTATACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162233    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201520.1-169s1c1
Sequence:CCGGCACTACCGAAATGTCTTCCATCTCGAGATGGAAGACATTTCGGTAGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164267    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201520.1-450s1c1
Sequence:CCGGCTCAGAAATTGCTGTAGGGCACTCGAGTGCCCTACAGCAATTTCTGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201520.1-785s1c1
Sequence:CCGGCCAAGTTCTCAGCAACATCATCTCGAGATGATGTTGCTGAGAACTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201520.1-687s1c1
Sequence:CCGGGAGTGGCATTGCAGTTGTCTTCTCGAGAAGACAACTGCAATGCCACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_201520
SLC25A35 MISSION shRNA Lentiviral Transduction Particles
solute carrier family 25, member 35
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000164320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201520.1-174s1c1
Sequence:CCGGCCGAAATGTCTTCCATGCCTTCTCGAGAAGGCATGGAAGACATTTCGGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000162805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201520.1-409s1c1
Sequence:CCGGCCCATCTACATGGTGAAGACACTCGAGTGTCTTCACCATGTAGATGGGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000163634    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_201520.1-2351s1c1
Sequence:CCGGGCTCCCTAAGTGCTGGAATTACTCGAGTAATTCCAGCACTTAGGGAGCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000159585    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_201520.1-2082s1c1
Sequence:CCGGCCTCTTGATTGATTGATTGATCTCGAGATCAATCAATCAATCAAGAGGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000164291    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201520.1-784s1c1
Sequence:CCGGCCCAAGTTCTCAGCAACATCACTCGAGTGATGTTGCTGAGAACTTGGGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000161576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201520.1-474s1c1
Sequence:CCGGGTATAAGCATCAGGGCATGTTCTCGAGAACATGCCCTGATGCTTATACTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000162233    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201520.1-169s1c1
Sequence:CCGGCACTACCGAAATGTCTTCCATCTCGAGATGGAAGACATTTCGGTAGTGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000164267    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201520.1-450s1c1
Sequence:CCGGCTCAGAAATTGCTGTAGGGCACTCGAGTGCCCTACAGCAATTTCTGAGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000162377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201520.1-785s1c1
Sequence:CCGGCCAAGTTCTCAGCAACATCATCTCGAGATGATGTTGCTGAGAACTTGGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000163721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201520.1-687s1c1
Sequence:CCGGGAGTGGCATTGCAGTTGTCTTCTCGAGAAGACAACTGCAATGCCACTCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???