EMAIL THIS PAGE TO A FRIEND

SLC25A48

solute carrier family 25, member 48

45 Gene Product Result for
UniProtKB ID: Q6ZT89, Q8TAV9
Gene ID:
Mouse(328258) solute carrier family 25, member 48
Rat(361206) solute carrier family 25, member 48
Zebrafish(436640) solute carrier family 25, member 48
chicken(416308) solute carrier family 25, member 48
domestic cat(101088211) solute carrier family 25, member 48
dog(481518) solute carrier family 25, member 48
domestic guinea pig(100731758) solute carrier family 25, member 48
naked mole-rat(101704386) solute carrier family 25, member 48
cow(515496) solute carrier family 25, member 48
sheep(101119819) solute carrier family 25, member 48
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_177809 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177809 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177809 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_145282 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_145282 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_145282 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_145282 Rosetta Predictions human pricing
XM_001068301 Rosetta Predictions rat pricing
XM_341488 Rosetta Predictions rat pricing
NM_177809 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145282 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00365160 predicted 362
2 SASI_Hs01_00168850 predicted 742
3 SASI_Hs01_00168851 predicted 325
4 SASI_Hs01_00168852 predicted 712
5 SASI_Hs01_00168853 predicted 657
6 SASI_Hs01_00168854 predicted 322
7 SASI_Hs01_00168855 predicted 739
8 SASI_Hs01_00168856 predicted 378
9 SASI_Hs01_00168857 predicted 724
10 SASI_Hs01_00168858 predicted 372
11 SASI_Hs01_00168859 predicted 334
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001068301 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00324141 predicted 357
2 SASI_Rn02_00324142 predicted 585
3 SASI_Rn02_00324143 predicted 776
4 SASI_Rn02_00324144 predicted 631
5 SASI_Rn02_00324145 predicted 640
6 SASI_Rn02_00324146 predicted 357
7 SASI_Rn02_00324147 predicted 652
8 SASI_Rn02_00324148 predicted 489
9 SASI_Rn02_00324149 predicted 670
10 SASI_Rn02_00324150 predicted 375
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_341488 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00393012 predicted 1163
2 SASI_Rn02_00393013 predicted 1157
3 SASI_Rn02_00393014 predicted 1029
4 SASI_Rn02_00393015 predicted 1032
5 SASI_Rn02_00393016 predicted 1030
6 SASI_Rn02_00393017 predicted 1049
7 SASI_Rn02_00393018 predicted 998
8 SASI_Rn02_00393019 predicted 1037
9 SASI_Rn02_00393020 predicted 1059
10 SASI_Rn02_00393021 predicted 1045
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177809 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00101377 predicted 1105
2 SASI_Mm02_00348252 predicted 1043
3 SASI_Mm01_00101378 predicted 1088
4 SASI_Mm02_00348253 predicted 1111
5 SASI_Mm01_00101379 predicted 1049
6 SASI_Mm01_00101380 predicted 686
7 SASI_Mm01_00101381 predicted 821
8 SASI_Mm01_00101382 predicted 1132
9 SASI_Mm01_00101383 predicted 983
10 SASI_Mm01_00101384 predicted 910
11 SASI_Mm01_00101376 predicted 697
12 SASI_Mm01_00101385 predicted 1095
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177809
SLC25A48 MISSION shRNA Bacterial Glycerol Stock
solute carrier family 25, member 48
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000105269    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177809.2-986s1c1
Sequence:CCGGGCGGCCATGTTCCTCGGGTATCTCGAGATACCCGAGGAACATGGCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105265    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177809.2-1206s1c1
Sequence:CCGGCGTGGTTTAAATCTTCAGCTACTCGAGTAGCTGAAGATTTAAACCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105266    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177809.2-688s1c1
Sequence:CCGGCCCGGGATATTGCTTCTACTTCTCGAGAAGTAGAAGCAATATCCCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105268    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177809.2-259s1c1
Sequence:CCGGCACATTCAACTGCATCCGCATCTCGAGATGCGGATGCAGTTGAATGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105267    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177809.2-690s1c1
Sequence:CCGGCGGGATATTGCTTCTACTTTACTCGAGTAAAGTAGAAGCAATATCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177809
SLC25A48 MISSION shRNA shRNA Plasmid DNA
solute carrier family 25, member 48
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000105269    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177809.2-986s1c1
Sequence:CCGGGCGGCCATGTTCCTCGGGTATCTCGAGATACCCGAGGAACATGGCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105265    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177809.2-1206s1c1
Sequence:CCGGCGTGGTTTAAATCTTCAGCTACTCGAGTAGCTGAAGATTTAAACCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105266    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177809.2-688s1c1
Sequence:CCGGCCCGGGATATTGCTTCTACTTCTCGAGAAGTAGAAGCAATATCCCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105268    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177809.2-259s1c1
Sequence:CCGGCACATTCAACTGCATCCGCATCTCGAGATGCGGATGCAGTTGAATGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105267    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177809.2-690s1c1
Sequence:CCGGCGGGATATTGCTTCTACTTTACTCGAGTAAAGTAGAAGCAATATCCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177809
SLC25A48 MISSION shRNA Lentiviral Transduction Particles
solute carrier family 25, member 48
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000105269    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177809.2-986s1c1
Sequence:CCGGGCGGCCATGTTCCTCGGGTATCTCGAGATACCCGAGGAACATGGCCGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000105265    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177809.2-1206s1c1
Sequence:CCGGCGTGGTTTAAATCTTCAGCTACTCGAGTAGCTGAAGATTTAAACCACGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000105266    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177809.2-688s1c1
Sequence:CCGGCCCGGGATATTGCTTCTACTTCTCGAGAAGTAGAAGCAATATCCCGGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000105268    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177809.2-259s1c1
Sequence:CCGGCACATTCAACTGCATCCGCATCTCGAGATGCGGATGCAGTTGAATGTGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000105267    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177809.2-690s1c1
Sequence:CCGGCGGGATATTGCTTCTACTTTACTCGAGTAAAGTAGAAGCAATATCCCGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145282
SLC25A48 MISSION shRNA Bacterial Glycerol Stock
solute carrier family 25, member 48
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000165161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145282.1-548s1c1
Sequence:CCGGGAACACAGGATGACTACAGTGCTCGAGCACTGTAGTCATCCTGTGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145282.1-292s1c1
Sequence:CCGGCTTCTTCAAGGGCATGTCCTTCTCGAGAAGGACATGCCCTTGAAGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145282.1-627s1c1
Sequence:CCGGGACCTCCAAGTGGACATCAATCTCGAGATTGATGTCCACTTGGAGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166137    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145282.1-515s1c1
Sequence:CCGGCAGATGCAGACACAACCGTTTCTCGAGAAACGGTTGTGTCTGCATCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145282.1-332s1c1
Sequence:CCGGGTCTACAACTCCGTGGTGTTTCTCGAGAAACACCACGGAGTTGTAGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164878    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145282.1-278s1c1
Sequence:CCGGGAGAGTATGTTCGGCTTCTTCCTCGAGGAAGAAGCCGAACATACTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145282.1-629s1c1
Sequence:CCGGCCTCCAAGTGGACATCAATTACTCGAGTAATTGATGTCCACTTGGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159500    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145282.1-633s1c1
Sequence:CCGGCAAGTGGACATCAATTAGCAACTCGAGTTGCTAATTGATGTCCACTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145282.1-781s1c1
Sequence:CCGGGCTTTCCAAGAAATGTTTGGTCTCGAGACCAAACATTTCTTGGAAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145282.1-280s1c1
Sequence:CCGGGAGTATGTTCGGCTTCTTCAACTCGAGTTGAAGAAGCCGAACATACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145282.1-707s1c1
Sequence:CCGGCCTCATGAGTCACTGATTCAACTCGAGTTGAATCAGTGACTCATGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165403    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145282.1-499s1c1
Sequence:CCGGCATCAAGATCCGGTTGCAGATCTCGAGATCTGCAACCGGATCTTGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165300    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145282.1-543s1c1
Sequence:CCGGGAGGTGAACACAGGATGACTACTCGAGTAGTCATCCTGTGTTCACCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145282
SLC25A48 MISSION shRNA shRNA Plasmid DNA
solute carrier family 25, member 48
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000165161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145282.1-548s1c1
Sequence:CCGGGAACACAGGATGACTACAGTGCTCGAGCACTGTAGTCATCCTGTGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145282.1-292s1c1
Sequence:CCGGCTTCTTCAAGGGCATGTCCTTCTCGAGAAGGACATGCCCTTGAAGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145282.1-627s1c1
Sequence:CCGGGACCTCCAAGTGGACATCAATCTCGAGATTGATGTCCACTTGGAGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166137    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145282.1-515s1c1
Sequence:CCGGCAGATGCAGACACAACCGTTTCTCGAGAAACGGTTGTGTCTGCATCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145282.1-332s1c1
Sequence:CCGGGTCTACAACTCCGTGGTGTTTCTCGAGAAACACCACGGAGTTGTAGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164878    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145282.1-278s1c1
Sequence:CCGGGAGAGTATGTTCGGCTTCTTCCTCGAGGAAGAAGCCGAACATACTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145282.1-629s1c1
Sequence:CCGGCCTCCAAGTGGACATCAATTACTCGAGTAATTGATGTCCACTTGGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159500    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145282.1-633s1c1
Sequence:CCGGCAAGTGGACATCAATTAGCAACTCGAGTTGCTAATTGATGTCCACTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145282.1-781s1c1
Sequence:CCGGGCTTTCCAAGAAATGTTTGGTCTCGAGACCAAACATTTCTTGGAAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145282.1-280s1c1
Sequence:CCGGGAGTATGTTCGGCTTCTTCAACTCGAGTTGAAGAAGCCGAACATACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145282.1-707s1c1
Sequence:CCGGCCTCATGAGTCACTGATTCAACTCGAGTTGAATCAGTGACTCATGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165403    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145282.1-499s1c1
Sequence:CCGGCATCAAGATCCGGTTGCAGATCTCGAGATCTGCAACCGGATCTTGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165300    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145282.1-543s1c1
Sequence:CCGGGAGGTGAACACAGGATGACTACTCGAGTAGTCATCCTGTGTTCACCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145282
SLC25A48 MISSION shRNA Lentiviral Transduction Particles
solute carrier family 25, member 48
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000165161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145282.1-548s1c1
Sequence:CCGGGAACACAGGATGACTACAGTGCTCGAGCACTGTAGTCATCCTGTGTTCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000165730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145282.1-292s1c1
Sequence:CCGGCTTCTTCAAGGGCATGTCCTTCTCGAGAAGGACATGCCCTTGAAGAAGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000164907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145282.1-627s1c1
Sequence:CCGGGACCTCCAAGTGGACATCAATCTCGAGATTGATGTCCACTTGGAGGTCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000166137    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145282.1-515s1c1
Sequence:CCGGCAGATGCAGACACAACCGTTTCTCGAGAAACGGTTGTGTCTGCATCTGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000164906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145282.1-332s1c1
Sequence:CCGGGTCTACAACTCCGTGGTGTTTCTCGAGAAACACCACGGAGTTGTAGACTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000164878    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145282.1-278s1c1
Sequence:CCGGGAGAGTATGTTCGGCTTCTTCCTCGAGGAAGAAGCCGAACATACTCTCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000162251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145282.1-629s1c1
Sequence:CCGGCCTCCAAGTGGACATCAATTACTCGAGTAATTGATGTCCACTTGGAGGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000159500    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145282.1-633s1c1
Sequence:CCGGCAAGTGGACATCAATTAGCAACTCGAGTTGCTAATTGATGTCCACTTGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000158718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145282.1-781s1c1
Sequence:CCGGGCTTTCCAAGAAATGTTTGGTCTCGAGACCAAACATTTCTTGGAAAGCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000161226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145282.1-280s1c1
Sequence:CCGGGAGTATGTTCGGCTTCTTCAACTCGAGTTGAAGAAGCCGAACATACTCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000162461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145282.1-707s1c1
Sequence:CCGGCCTCATGAGTCACTGATTCAACTCGAGTTGAATCAGTGACTCATGAGGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000165403    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145282.1-499s1c1
Sequence:CCGGCATCAAGATCCGGTTGCAGATCTCGAGATCTGCAACCGGATCTTGATGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000165300    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145282.1-543s1c1
Sequence:CCGGGAGGTGAACACAGGATGACTACTCGAGTAGTCATCCTGTGTTCACCTCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???