EMAIL THIS PAGE TO A FRIEND

SLC25A4

solute carrier family 25 (mitochondrial carrier; adenine nucleotide translocator), member 4

106 Gene Product Result for
Synonyms: 1 AAC1 ANT ANT 1 ANT1 PEO2 PEO3 T1
UniProtKB ID: P12235, D3DP59
Gene ID:
Human(291) Summary: This gene is a member of the mitochondrial carrier subfamily of solute carrier protein genes. The product of this gene functions as a gated pore that translocates ADP from the cytoplasm into the mitochondrial matrix and ATP from the mitochondrial matrix into the cytoplasm. The protein forms a homodimer embedded in the inner mitochondria membrane. Mutations in this gene have been shown to result in autosomal dominant progressive external opthalmoplegia and familial hypertrophic cardiomyopathy. [provided by RefSeq, Jun 2013]
Mouse(11739) solute carrier family 25 (mitochondrial carrier, adenine nucleotide translocator), member 4
Rat(85333) solute carrier family 25 (mitochondrial carrier; adenine nucleotide translocator), member 4
Zebrafish(327067) solute carrier family 25 (mitochondrial carrier; adenine nucleotide translocator), member 4
dog(475630) solute carrier family 25 (mitochondrial carrier; adenine nucleotide translocator), member 4
domestic cat(101096309) solute carrier family 25 (mitochondrial carrier; adenine nucleotide translocator), member 4
chicken(422546) solute carrier family 25 (mitochondrial carrier; adenine nucleotide translocator), member 4
cow(282478) solute carrier family 25 (mitochondrial carrier; adenine nucleotide translocator), member 4
sheep(100147787) solute carrier family 25 (mitochondrial carrier; adenine nucleotide translocator), member 4
Goat(100861351) solute carrier family 25 (mitochondrial carrier; adenine nucleotide translocator), member 4
Domestic Rabbit(100009414) solute carrier family 25 (mitochondrial carrier; adenine nucleotide translocator), member 4
naked mole-rat(101706144) solute carrier family 25 (mitochondrial carrier; adenine nucleotide translocator), member 4
domestic guinea pig(100728327) solute carrier family 25 (mitochondrial carrier; adenine nucleotide translocator), member 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2108761 Anti-SLC25A4 affinity isolated antibody rabbit, sheep, mouse, bovine, rat, human, goat, guinea pig, dog
immunohistochemistry, western blot pricing
SAB4300887 Anti-SLC25A4 antibody produced in rabbit affinity isolated antibody rat, mouse, human
western blot pricing
SAB2105530 Anti-SLC25A4, (N-terminal) antibody produced in rabbit affinity isolated antibody goat, sheep, guinea pig, human, horse, rabbit
western blot pricing
WH0000291M1 Monoclonal Anti-SLC25A4 antibody produced in mouse clone 3E1, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001151 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001151 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001151 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_134169 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_134169 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_134169 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001151 Rosetta Predictions human pricing
NM_053515 Rosetta Predictions rat pricing
NM_007450 Rosetta Predictions mouse pricing
XM_134169 Rosetta Predictions mouse pricing
XM_896932 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001151 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00079431 predicted 1083
2 SASI_Hs02_00331249 predicted 433
3 SASI_Hs01_00079432 predicted 1072
4 SASI_Hs01_00079434 predicted 654
5 SASI_Hs01_00079435 predicted 1045
6 SASI_Hs02_00331250 predicted 586
7 SASI_Hs02_00331251 predicted 603
8 SASI_Hs01_00079436 predicted 923
9 SASI_Hs02_00331252 predicted 1081
10 SASI_Hs02_00331253 predicted 1054
11 SASI_Hs01_00079429 predicted 830
12 SASI_Hs01_00079430 predicted 692
13 SASI_Hs01_00079433 predicted 829
14 SASI_Hs01_00079437 predicted 296
15 SASI_Hs01_00079438 predicted 275
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053515 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00058238 predicted 405
2 SASI_Rn01_00058239 predicted 581
3 SASI_Rn01_00058240 predicted 605
4 SASI_Rn01_00058241 predicted 728
5 SASI_Rn01_00058242 predicted 477
6 SASI_Rn01_00058243 predicted 860
7 SASI_Rn01_00058244 predicted 815
8 SASI_Rn01_00058245 predicted 370
9 SASI_Rn01_00058246 predicted 742
10 SASI_Rn02_00266124 predicted 786
11 SASI_Rn01_00058247 predicted 690
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007450 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00163105 predicted 786
2 SASI_Mm02_00311633 predicted 519
3 SASI_Mm02_00311634 predicted 643
4 SASI_Mm01_00163107 predicted 589
5 SASI_Mm01_00163108 predicted 783
6 SASI_Mm01_00163109 predicted 524
7 SASI_Mm01_00163113 predicted 797
8 SASI_Mm02_00311635 predicted 241
9 SASI_Mm02_00311636 predicted 757
10 SASI_Mm02_00311637 predicted 555
11 SASI_Mm01_00163106 predicted 730
12 SASI_Mm01_00163110 predicted 1006
13 SASI_Mm01_00163111 predicted 554
14 SASI_Mm01_00163112 predicted 745
15 SASI_Mm01_00163114 predicted 382
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_134169 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00259518 predicted 799
2 SASI_Mm01_00259519 predicted 932
3 SASI_Mm01_00259520 predicted 618
4 SASI_Mm01_00259521 predicted 870
5 SASI_Mm01_00259522 predicted 799
6 SASI_Mm01_00259523 predicted 808
7 SASI_Mm01_00259524 predicted 1004
8 SASI_Mm01_00259525 predicted 1036
9 SASI_Mm01_00259526 predicted 834
10 SASI_Mm01_00259527 predicted 1044
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_896932 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00274695 predicted 806
2 SASI_Mm01_00274696 predicted 615
3 SASI_Mm01_00274697 predicted 669
4 SASI_Mm01_00274698 predicted 869
5 SASI_Mm01_00274699 predicted 802
6 SASI_Mm01_00274700 predicted 806
7 SASI_Mm01_00274701 predicted 633
8 SASI_Mm01_00274702 predicted 834
9 SASI_Mm01_00274703 predicted 844
10 SASI_Mm01_00274704 predicted 634
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001151
VALIDATED
SLC25A4 MISSION shRNA Bacterial Glycerol Stock
solute carrier family 25 (mitochondrial carrier; adenine nucleotide translocator), member 4
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000289204    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001151.2-705s21c1
Sequence:CCGGCGGAGTCTATGATACTGCCAACTCGAGTTGGCAGTATCATAGACTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289147    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001151.2-994s21c1
Sequence:CCGGGTGTTGTATGATGAGATCAAACTCGAGTTTGATCTCATCATACAACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289148    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001151.2-603s21c1
Sequence:CCGGCGACTGTATCATCAAGATCTTCTCGAGAAGATCTTGATGATACAGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289205    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001151.2-818s21c1
Sequence:CCGGCCTTTGACACTGTTCGTCGTACTCGAGTACGACGAACAGTGTCAAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044964    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001151.1-965s1c1
Sequence:CCGGGTGTTGTATGATGAGATCAAACTCGAGTTTGATCTCATCATACAACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001151.1-574s1c1
Sequence:CCGGCGACTGTATCATCAAGATCTTCTCGAGAAGATCTTGATGATACAGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001151.1-247s1c1
Sequence:CCGGGAAGCAGTACAAAGGGATCATCTCGAGATGATCCCTTTGTACTGCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044965    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001151.1-789s1c1
Sequence:CCGGCCTTTGACACTGTTCGTCGTACTCGAGTACGACGAACAGTGTCAAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001151.1-676s1c1
Sequence:CCGGCGGAGTCTATGATACTGCCAACTCGAGTTGGCAGTATCATAGACTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289207    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001151.2-273s21c1
Sequence:CCGGGAAGCAGTACAAAGGGATCATCTCGAGATGATCCCTTTGTACTGCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001151
VALIDATED
SLC25A4 MISSION shRNA shRNA Plasmid DNA
solute carrier family 25 (mitochondrial carrier; adenine nucleotide translocator), member 4
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000289204    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001151.2-705s21c1
Sequence:CCGGCGGAGTCTATGATACTGCCAACTCGAGTTGGCAGTATCATAGACTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000289147    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001151.2-994s21c1
Sequence:CCGGGTGTTGTATGATGAGATCAAACTCGAGTTTGATCTCATCATACAACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000289148    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001151.2-603s21c1
Sequence:CCGGCGACTGTATCATCAAGATCTTCTCGAGAAGATCTTGATGATACAGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000289205    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001151.2-818s21c1
Sequence:CCGGCCTTTGACACTGTTCGTCGTACTCGAGTACGACGAACAGTGTCAAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044964    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001151.1-965s1c1
Sequence:CCGGGTGTTGTATGATGAGATCAAACTCGAGTTTGATCTCATCATACAACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001151.1-574s1c1
Sequence:CCGGCGACTGTATCATCAAGATCTTCTCGAGAAGATCTTGATGATACAGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001151.1-247s1c1
Sequence:CCGGGAAGCAGTACAAAGGGATCATCTCGAGATGATCCCTTTGTACTGCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044965    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001151.1-789s1c1
Sequence:CCGGCCTTTGACACTGTTCGTCGTACTCGAGTACGACGAACAGTGTCAAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001151.1-676s1c1
Sequence:CCGGCGGAGTCTATGATACTGCCAACTCGAGTTGGCAGTATCATAGACTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000289207    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001151.2-273s21c1
Sequence:CCGGGAAGCAGTACAAAGGGATCATCTCGAGATGATCCCTTTGTACTGCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001151
VALIDATED
SLC25A4 MISSION shRNA Lentiviral Transduction Particles
solute carrier family 25 (mitochondrial carrier; adenine nucleotide translocator), member 4
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000289204    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001151.2-705s21c1
Sequence:CCGGCGGAGTCTATGATACTGCCAACTCGAGTTGGCAGTATCATAGACTCCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000289147    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001151.2-994s21c1
Sequence:CCGGGTGTTGTATGATGAGATCAAACTCGAGTTTGATCTCATCATACAACACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000289148    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001151.2-603s21c1
Sequence:CCGGCGACTGTATCATCAAGATCTTCTCGAGAAGATCTTGATGATACAGTCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000289205    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001151.2-818s21c1
Sequence:CCGGCCTTTGACACTGTTCGTCGTACTCGAGTACGACGAACAGTGTCAAAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044964    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001151.1-965s1c1
Sequence:CCGGGTGTTGTATGATGAGATCAAACTCGAGTTTGATCTCATCATACAACACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001151.1-574s1c1
Sequence:CCGGCGACTGTATCATCAAGATCTTCTCGAGAAGATCTTGATGATACAGTCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001151.1-247s1c1
Sequence:CCGGGAAGCAGTACAAAGGGATCATCTCGAGATGATCCCTTTGTACTGCTTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044965    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001151.1-789s1c1
Sequence:CCGGCCTTTGACACTGTTCGTCGTACTCGAGTACGACGAACAGTGTCAAAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001151.1-676s1c1
Sequence:CCGGCGGAGTCTATGATACTGCCAACTCGAGTTGGCAGTATCATAGACTCCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000289207    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001151.2-273s21c1
Sequence:CCGGGAAGCAGTACAAAGGGATCATCTCGAGATGATCCCTTTGTACTGCTTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_134169
SLC25A4 MISSION shRNA Bacterial Glycerol Stock
solute carrier family 25 (mitochondrial carrier; adenine nucleotide translocator), member 4
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000069157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_134169.4-873s1c1
Sequence:CCGGGTCCAATGTACTGAGAGGCATCTCGAGATGCCTCTCAGTACATTGGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069153    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_134169.4-672s1c1
Sequence:CCGGGCACATTATCGTGAGCTGGATCTCGAGATCCAGCTCACGATAATGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_134169.4-174s1c1
Sequence:CCGGCAAACAGATCAGTGCAGAGAACTCGAGTTCTCTGCACTGATCTGTTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_134169.4-209s1c1
Sequence:CCGGTCATTGATTGTGTCGTGAGAACTCGAGTTCTCACGACACAATCAATGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069155    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_134169.4-312s1c1
Sequence:CCGGCTTCGCCTTCAAAGACAAGTACTCGAGTACTTGTCTTTGAAGGCGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_134169
SLC25A4 MISSION shRNA shRNA Plasmid DNA
solute carrier family 25 (mitochondrial carrier; adenine nucleotide translocator), member 4
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000069157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_134169.4-873s1c1
Sequence:CCGGGTCCAATGTACTGAGAGGCATCTCGAGATGCCTCTCAGTACATTGGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069153    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_134169.4-672s1c1
Sequence:CCGGGCACATTATCGTGAGCTGGATCTCGAGATCCAGCTCACGATAATGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_134169.4-174s1c1
Sequence:CCGGCAAACAGATCAGTGCAGAGAACTCGAGTTCTCTGCACTGATCTGTTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_134169.4-209s1c1
Sequence:CCGGTCATTGATTGTGTCGTGAGAACTCGAGTTCTCACGACACAATCAATGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069155    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_134169.4-312s1c1
Sequence:CCGGCTTCGCCTTCAAAGACAAGTACTCGAGTACTTGTCTTTGAAGGCGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_134169
SLC25A4 MISSION shRNA Lentiviral Transduction Particles
solute carrier family 25 (mitochondrial carrier; adenine nucleotide translocator), member 4
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000069157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_134169.4-873s1c1
Sequence:CCGGGTCCAATGTACTGAGAGGCATCTCGAGATGCCTCTCAGTACATTGGACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069153    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_134169.4-672s1c1
Sequence:CCGGGCACATTATCGTGAGCTGGATCTCGAGATCCAGCTCACGATAATGTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_134169.4-174s1c1
Sequence:CCGGCAAACAGATCAGTGCAGAGAACTCGAGTTCTCTGCACTGATCTGTTTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_134169.4-209s1c1
Sequence:CCGGTCATTGATTGTGTCGTGAGAACTCGAGTTCTCACGACACAATCAATGATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069155    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_134169.4-312s1c1
Sequence:CCGGCTTCGCCTTCAAAGACAAGTACTCGAGTACTTGTCTTTGAAGGCGAAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)