EMAIL THIS PAGE TO A FRIEND

SLC25A53

solute carrier family 25, member 53

245 Gene Product Result for
Synonyms: MCART6
UniProtKB ID: Q5H9E4, B2RTT9
Gene ID:
Mouse(67062) solute carrier family 25, member 53
naked mole-rat(101701580) solute carrier family 25, member 53
cow(789233) solute carrier family 25, member 53
sheep(101122501) solute carrier family 25, member 53
dog(492039) solute carrier family 25, member 53
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001012755 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001012755 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001012755 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001082412 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001082412 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001082412 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001012755 Rosetta Predictions human pricing
NM_001082412 Rosetta Predictions mouse pricing
NM_001114179 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012755 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ?
1 SASI_Hs02_00306244 predicted 1075
2 SASI_Hs01_00225565 predicted 450
3 SASI_Hs01_00225566 predicted 968
4 SASI_Hs01_00225567 predicted 1189
5 SASI_Hs01_00225568 predicted 876
6 SASI_Hs01_00225569 predicted 898
7 SASI_Hs01_00225570 predicted 894
8 SASI_Hs01_00225571 predicted 1145
9 SASI_Hs01_00225572 predicted 855
10 SASI_Hs02_00306245 predicted 654
11 SASI_Hs01_00225573 predicted 847
12 SASI_Hs01_00225574 predicted 316
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001082412 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ?
1 SASI_Mm02_00299232 predicted 1608
2 SASI_Mm02_00299233 predicted 904
3 SASI_Mm02_00299234 predicted 992
4 SASI_Mm02_00299235 predicted 1618
5 SASI_Mm02_00299236 predicted 1388
6 SASI_Mm02_00299237 predicted 1439
7 SASI_Mm02_00299238 predicted 1666
8 SASI_Mm02_00299239 predicted 1381
9 SASI_Mm02_00299240 predicted 1420
10 SASI_Mm02_00299241 predicted 1081
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001114179 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ?
1 SASI_Mm02_00308480 predicted 992
2 SASI_Mm02_00308481 predicted 285
3 SASI_Mm02_00308482 predicted 371
4 SASI_Mm02_00308483 predicted 997
5 SASI_Mm02_00308484 predicted 771
6 SASI_Mm02_00308485 predicted 819
7 SASI_Mm02_00308486 predicted 1049
8 SASI_Mm02_00308487 predicted 764
9 SASI_Mm02_00308488 predicted 802
10 SASI_Mm02_00308489 predicted 460
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001012755
SLC25A53 MISSION shRNA Bacterial Glycerol Stock
solute carrier family 25, member 53
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000130582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012755.1-876s1c1
Sequence:CCGGCTGATTGTGCTGGTTGCTAATCTCGAGATTAGCAACCAGCACAATCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012755.1-285s1c1
Sequence:CCGGGCCGTTTCCAACTTTATGTCTCTCGAGAGACATAAAGTTGGAAACGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148132    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012755.1-891s1c1
Sequence:CCGGGCTAATATGCAGTCCCATATTCTCGAGAATATGGGACTGCATATTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150137    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001012755.1-5654s1c1
Sequence:CCGGGCCCTTTAATAACCTACTCTTCTCGAGAAGAGTAGGTTATTAAAGGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147804    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001012755.1-1199s1c1
Sequence:CCGGGCCATCCTTTAGCATCTATAACTCGAGTTATAGATGCTAAAGGATGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001012755
SLC25A53 MISSION shRNA shRNA Plasmid DNA
solute carrier family 25, member 53
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000130582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012755.1-876s1c1
Sequence:CCGGCTGATTGTGCTGGTTGCTAATCTCGAGATTAGCAACCAGCACAATCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012755.1-285s1c1
Sequence:CCGGGCCGTTTCCAACTTTATGTCTCTCGAGAGACATAAAGTTGGAAACGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148132    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012755.1-891s1c1
Sequence:CCGGGCTAATATGCAGTCCCATATTCTCGAGAATATGGGACTGCATATTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150137    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001012755.1-5654s1c1
Sequence:CCGGGCCCTTTAATAACCTACTCTTCTCGAGAAGAGTAGGTTATTAAAGGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147804    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001012755.1-1199s1c1
Sequence:CCGGGCCATCCTTTAGCATCTATAACTCGAGTTATAGATGCTAAAGGATGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001012755
SLC25A53 MISSION shRNA Lentiviral Transduction Particles
solute carrier family 25, member 53
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000130582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012755.1-876s1c1
Sequence:CCGGCTGATTGTGCTGGTTGCTAATCTCGAGATTAGCAACCAGCACAATCAGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012755.1-285s1c1
Sequence:CCGGGCCGTTTCCAACTTTATGTCTCTCGAGAGACATAAAGTTGGAAACGGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148132    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012755.1-891s1c1
Sequence:CCGGGCTAATATGCAGTCCCATATTCTCGAGAATATGGGACTGCATATTAGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150137    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001012755.1-5654s1c1
Sequence:CCGGGCCCTTTAATAACCTACTCTTCTCGAGAAGAGTAGGTTATTAAAGGGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147804    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001012755.1-1199s1c1
Sequence:CCGGGCCATCCTTTAGCATCTATAACTCGAGTTATAGATGCTAAAGGATGGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001082412
SLC25A53 MISSION shRNA Bacterial Glycerol Stock
solute carrier family 25, member 53
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000254351    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001082412.2-2484s21c1
Sequence:CCGGGTTGATATGGACAGCTATATACTCGAGTATATAGCTGTCCATATCAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265528    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001082412.2-1360s21c1
Sequence:CCGGTGGTGTCTGGTAGTGTCAATGCTCGAGCATTGACACTACCAGACACCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254350    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001082412.2-1222s21c1
Sequence:CCGGGGCTGTCACTGGGCTATTATCCTCGAGGATAATAGCCCAGTGACAGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254352    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001082412.2-1002s21c1
Sequence:CCGGTTTGGCACTTATGATAGTTTGCTCGAGCAAACTATCATAAGTGCCAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254353    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001082412.2-845s21c1
Sequence:CCGGCCTGACCTTTCCTATCTATAACTCGAGTTATAGATAGGAAAGGTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001082412
SLC25A53 MISSION shRNA shRNA Plasmid DNA
solute carrier family 25, member 53
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000254351    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001082412.2-2484s21c1
Sequence:CCGGGTTGATATGGACAGCTATATACTCGAGTATATAGCTGTCCATATCAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000265528    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001082412.2-1360s21c1
Sequence:CCGGTGGTGTCTGGTAGTGTCAATGCTCGAGCATTGACACTACCAGACACCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254350    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001082412.2-1222s21c1
Sequence:CCGGGGCTGTCACTGGGCTATTATCCTCGAGGATAATAGCCCAGTGACAGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254352    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001082412.2-1002s21c1
Sequence:CCGGTTTGGCACTTATGATAGTTTGCTCGAGCAAACTATCATAAGTGCCAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254353    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001082412.2-845s21c1
Sequence:CCGGCCTGACCTTTCCTATCTATAACTCGAGTTATAGATAGGAAAGGTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001082412
SLC25A53 MISSION shRNA Lentiviral Transduction Particles
solute carrier family 25, member 53
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000254351    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001082412.2-2484s21c1
Sequence:CCGGGTTGATATGGACAGCTATATACTCGAGTATATAGCTGTCCATATCAACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000265528    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001082412.2-1360s21c1
Sequence:CCGGTGGTGTCTGGTAGTGTCAATGCTCGAGCATTGACACTACCAGACACCATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254350    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001082412.2-1222s21c1
Sequence:CCGGGGCTGTCACTGGGCTATTATCCTCGAGGATAATAGCCCAGTGACAGCCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254352    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001082412.2-1002s21c1
Sequence:CCGGTTTGGCACTTATGATAGTTTGCTCGAGCAAACTATCATAAGTGCCAAATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254353    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001082412.2-845s21c1
Sequence:CCGGCCTGACCTTTCCTATCTATAACTCGAGTTATAGATAGGAAAGGTCAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)