EMAIL THIS PAGE TO A FRIEND

SLC25A5

solute carrier family 25 (mitochondrial carrier; adenine nucleotide translocator), member 5

48 Gene Product Result for
Synonyms: 2F1 AAC2 ANT2 T2 T3
UniProtKB ID: P05141, O43350
Gene ID:
Human(292) Summary: This gene is a member of the mitochondrial carrier subfamily of solute carrier protein genes. The product of this gene functions as a gated pore that translocates ADP from the cytoplasm into the mitochondrial matrix and ATP from the mitochondrial matrix into the cytoplasm. The protein forms a homodimer embedded in the inner mitochondria membrane. Suppressed expression of this gene has been shown to induce apoptosis and inhibit tumor growth. The human genome contains several non-transcribed pseudogenes of this gene.[provided by RefSeq, Jun 2013]
Mouse(11740) solute carrier family 25 (mitochondrial carrier, adenine nucleotide translocator), member 5
Rat(25176) solute carrier family 25 (mitochondrial carrier; adenine nucleotide translocator), member 5
cow(282479) solute carrier family 25 (mitochondrial carrier; adenine nucleotide translocator), member 5
sheep(100147788) solute carrier family 25 (mitochondrial carrier; adenine nucleotide translocator), member 5
naked mole-rat(101697130) solute carrier family 25 (mitochondrial carrier; adenine nucleotide translocator), member 5
domestic guinea pig(100722530) solute carrier family 25 (mitochondrial carrier; adenine nucleotide translocator), member 5
Zebrafish(192321) solute carrier family 25 alpha, member 5
chicken(772225) solute carrier family 25 (mitochondrial carrier; adenine nucleotide translocator), member 5
domestic cat(101082635) solute carrier family 25 (mitochondrial carrier; adenine nucleotide translocator), member 5
dog(492093) solute carrier family 25 (mitochondrial carrier; adenine nucleotide translocator), member 5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007451 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007451 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007451 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001152 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001152 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001152 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001152 Rosetta Predictions human pricing
NM_057102 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001152 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00029660 predicted 634
2 SASI_Hs01_00029662 predicted 547
3 SASI_Hs01_00029663 predicted 579
4 SASI_Hs01_00029664 predicted 559
5 SASI_Hs01_00029666 predicted 598
6 SASI_Hs02_00331254 predicted 1001
7 SASI_Hs01_00029665 predicted 648
8 SASI_Hs02_00331255 predicted 849
9 SASI_Hs02_00331256 predicted 202
10 SASI_Hs02_00331257 predicted 958
11 SASI_Hs01_00029661 predicted 1006
12 SASI_Hs01_00029667 predicted 663
13 SASI_Hs01_00029668 predicted 644
14 SASI_Hs01_00029669 predicted 298
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_057102 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00051401 predicted 208
2 SASI_Rn02_00267033 predicted 191
3 SASI_Rn01_00051402 predicted 835
4 SASI_Rn01_00051403 predicted 624
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007451
VALIDATED
SLC25A5 MISSION shRNA Bacterial Glycerol Stock
solute carrier family 25 (mitochondrial carrier; adenine nucleotide translocator), member 5
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000331538    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007451.3-1077s21c1
Sequence:CCGGGCAACTATTTACCAGTTGAAACTCGAGTTTCAACTGGTAAATAGTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302299    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007451.3-335s21c1
Sequence:CCGGGCTCTCAACTTTGCCTTCAAACTCGAGTTTGAAGGCAAAGTTGAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302361    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007451.3-204s21c1
Sequence:CCGGGCAAGCAAATCACGGCAGATACTCGAGTATCTGCCGTGATTTGCTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302360    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007451.3-932s21c1
Sequence:CCGGGCCTTTGTGCTTGTCTTGTATCTCGAGATACAAGACAAGCACAAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302358    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007451.3-644s21c1
Sequence:CCGGGCTGCCTACTTTGGTATCTATCTCGAGATAGATACCAAAGTAGGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054754    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007451.2-336s1c1
Sequence:CCGGGCTCTCAACTTTGCCTTCAAACTCGAGTTTGAAGGCAAAGTTGAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054755    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007451.2-645s1c1
Sequence:CCGGGCTGCCTACTTTGGTATCTATCTCGAGATAGATACCAAAGTAGGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054756    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007451.2-205s1c1
Sequence:CCGGGCAAGCAAATCACGGCAGATACTCGAGTATCTGCCGTGATTTGCTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054757    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007451.2-933s1c1
Sequence:CCGGGCCTTTGTGCTTGTCTTGTATCTCGAGATACAAGACAAGCACAAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054753    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007451.2-1078s1c1
Sequence:CCGGGCAACTATTTACCAGTTGAAACTCGAGTTTCAACTGGTAAATAGTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007451
VALIDATED
SLC25A5 MISSION shRNA shRNA Plasmid DNA
solute carrier family 25 (mitochondrial carrier; adenine nucleotide translocator), member 5
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000331538    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007451.3-1077s21c1
Sequence:CCGGGCAACTATTTACCAGTTGAAACTCGAGTTTCAACTGGTAAATAGTTGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000302299    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007451.3-335s21c1
Sequence:CCGGGCTCTCAACTTTGCCTTCAAACTCGAGTTTGAAGGCAAAGTTGAGAGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000302361    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007451.3-204s21c1
Sequence:CCGGGCAAGCAAATCACGGCAGATACTCGAGTATCTGCCGTGATTTGCTTGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000302360    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007451.3-932s21c1
Sequence:CCGGGCCTTTGTGCTTGTCTTGTATCTCGAGATACAAGACAAGCACAAAGGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000302358    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007451.3-644s21c1
Sequence:CCGGGCTGCCTACTTTGGTATCTATCTCGAGATAGATACCAAAGTAGGCAGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000054754    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007451.2-336s1c1
Sequence:CCGGGCTCTCAACTTTGCCTTCAAACTCGAGTTTGAAGGCAAAGTTGAGAGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000054755    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007451.2-645s1c1
Sequence:CCGGGCTGCCTACTTTGGTATCTATCTCGAGATAGATACCAAAGTAGGCAGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000054756    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007451.2-205s1c1
Sequence:CCGGGCAAGCAAATCACGGCAGATACTCGAGTATCTGCCGTGATTTGCTTGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000054757    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007451.2-933s1c1
Sequence:CCGGGCCTTTGTGCTTGTCTTGTATCTCGAGATACAAGACAAGCACAAAGGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000054753    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007451.2-1078s1c1
Sequence:CCGGGCAACTATTTACCAGTTGAAACTCGAGTTTCAACTGGTAAATAGTTGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007451
VALIDATED
SLC25A5 MISSION shRNA Lentiviral Transduction Particles
solute carrier family 25 (mitochondrial carrier; adenine nucleotide translocator), member 5
Mouse
10 Products Total
TRC Number Volume Titer/mL Vector Price Set Price (5+)? Select
TRCN0000331538    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007451.3-1077s21c1
Sequence:CCGGGCAACTATTTACCAGTTGAAACTCGAGTTTCAACTGGTAAATAGTTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000302299    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007451.3-335s21c1
Sequence:CCGGGCTCTCAACTTTGCCTTCAAACTCGAGTTTGAAGGCAAAGTTGAGAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000302361    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007451.3-204s21c1
Sequence:CCGGGCAAGCAAATCACGGCAGATACTCGAGTATCTGCCGTGATTTGCTTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000302360    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007451.3-932s21c1
Sequence:CCGGGCCTTTGTGCTTGTCTTGTATCTCGAGATACAAGACAAGCACAAAGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000302358    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007451.3-644s21c1
Sequence:CCGGGCTGCCTACTTTGGTATCTATCTCGAGATAGATACCAAAGTAGGCAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054754    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007451.2-336s1c1
Sequence:CCGGGCTCTCAACTTTGCCTTCAAACTCGAGTTTGAAGGCAAAGTTGAGAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054755    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007451.2-645s1c1
Sequence:CCGGGCTGCCTACTTTGGTATCTATCTCGAGATAGATACCAAAGTAGGCAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054756    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007451.2-205s1c1
Sequence:CCGGGCAAGCAAATCACGGCAGATACTCGAGTATCTGCCGTGATTTGCTTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054757    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007451.2-933s1c1
Sequence:CCGGGCCTTTGTGCTTGTCTTGTATCTCGAGATACAAGACAAGCACAAAGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054753    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007451.2-1078s1c1
Sequence:CCGGGCAACTATTTACCAGTTGAAACTCGAGTTTCAACTGGTAAATAGTTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001152
VALIDATED
SLC25A5 MISSION shRNA Bacterial Glycerol Stock
solute carrier family 25 (mitochondrial carrier; adenine nucleotide translocator), member 5
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000219046    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_001152.2-997s21c1
Sequence:GTACCGGGTGAACAGGCATGTTGTATTACTCGAGTAATACAACATGCCTGTTCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230804    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 2 Clone ID:NM_001152.2-609s21c1
Sequence:CCGGGTGTCTGTGCAGGGTATTATCCTCGAGGATAATACCCTGCACAGACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230805    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_001152.2-640s21c1
Sequence:CCGGCCGCCTACTTCGGTATCTATGCTCGAGCATAGATACCGAAGTAGGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218929    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_001152.2-220s21c1
Sequence:GTACCGGAGCAATACAAAGGCATTATAGCTCGAGCTATAATGCCTTTGTATTGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230806    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_001152.2-956s21c1
Sequence:CCGGCAAGAAGTACACATAAGTTATCTCGAGATAACTTATGTGTACTTCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001152.1-633s1c1
Sequence:CCGGGCCGCCTACTTCGGTATCTATCTCGAGATAGATACCGAAGTAGGCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001152.1-290s1c1
Sequence:CCGGCCTGGCCAATGTCATCAGATACTCGAGTATCTGATGACATTGGCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001152.1-210s1c1
Sequence:CCGGGATAAGCAATACAAAGGCATTCTCGAGAATGCCTTTGTATTGCTTATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044984    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001152.1-644s1c1
Sequence:CCGGCGGTATCTATGACACTGCAAACTCGAGTTTGCAGTGTCATAGATACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044983    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001152.1-740s1c1
Sequence:CCGGCGGGTTGACTTCCTATCCATTCTCGAGAATGGATAGGAAGTCAACCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001152
VALIDATED
SLC25A5 MISSION shRNA shRNA Plasmid DNA
solute carrier family 25 (mitochondrial carrier; adenine nucleotide translocator), member 5
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000219046    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_001152.2-997s21c1
Sequence:GTACCGGGTGAACAGGCATGTTGTATTACTCGAGTAATACAACATGCCTGTTCACTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000230804    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 2 Clone ID:NM_001152.2-609s21c1
Sequence:CCGGGTGTCTGTGCAGGGTATTATCCTCGAGGATAATACCCTGCACAGACACTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000230805    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_001152.2-640s21c1
Sequence:CCGGCCGCCTACTTCGGTATCTATGCTCGAGCATAGATACCGAAGTAGGCGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000218929    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_001152.2-220s21c1
Sequence:GTACCGGAGCAATACAAAGGCATTATAGCTCGAGCTATAATGCCTTTGTATTGCTTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000230806    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_001152.2-956s21c1
Sequence:CCGGCAAGAAGTACACATAAGTTATCTCGAGATAACTTATGTGTACTTCTTGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000044987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001152.1-633s1c1
Sequence:CCGGGCCGCCTACTTCGGTATCTATCTCGAGATAGATACCGAAGTAGGCGGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000044986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001152.1-290s1c1
Sequence:CCGGCCTGGCCAATGTCATCAGATACTCGAGTATCTGATGACATTGGCCAGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000044985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001152.1-210s1c1
Sequence:CCGGGATAAGCAATACAAAGGCATTCTCGAGAATGCCTTTGTATTGCTTATCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000044984    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001152.1-644s1c1
Sequence:CCGGCGGTATCTATGACACTGCAAACTCGAGTTTGCAGTGTCATAGATACCGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000044983    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001152.1-740s1c1
Sequence:CCGGCGGGTTGACTTCCTATCCATTCTCGAGAATGGATAGGAAGTCAACCCGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001152
VALIDATED
SLC25A5 MISSION shRNA Lentiviral Transduction Particles
solute carrier family 25 (mitochondrial carrier; adenine nucleotide translocator), member 5
Human
10 Products Total
TRC Number Volume Titer/mL Vector Price Set Price (5+)? Select
TRCN0000219046    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_001152.2-997s21c1
Sequence:GTACCGGGTGAACAGGCATGTTGTATTACTCGAGTAATACAACATGCCTGTTCACTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230804    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 2 Clone ID:NM_001152.2-609s21c1
Sequence:CCGGGTGTCTGTGCAGGGTATTATCCTCGAGGATAATACCCTGCACAGACACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230805    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_001152.2-640s21c1
Sequence:CCGGCCGCCTACTTCGGTATCTATGCTCGAGCATAGATACCGAAGTAGGCGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218929    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_001152.2-220s21c1
Sequence:GTACCGGAGCAATACAAAGGCATTATAGCTCGAGCTATAATGCCTTTGTATTGCTTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230806    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_001152.2-956s21c1
Sequence:CCGGCAAGAAGTACACATAAGTTATCTCGAGATAACTTATGTGTACTTCTTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001152.1-633s1c1
Sequence:CCGGGCCGCCTACTTCGGTATCTATCTCGAGATAGATACCGAAGTAGGCGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001152.1-290s1c1
Sequence:CCGGCCTGGCCAATGTCATCAGATACTCGAGTATCTGATGACATTGGCCAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001152.1-210s1c1
Sequence:CCGGGATAAGCAATACAAAGGCATTCTCGAGAATGCCTTTGTATTGCTTATCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044984    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001152.1-644s1c1
Sequence:CCGGCGGTATCTATGACACTGCAAACTCGAGTTTGCAGTGTCATAGATACCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044983    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001152.1-740s1c1
Sequence:CCGGCGGGTTGACTTCCTATCCATTCTCGAGAATGGATAGGAAGTCAACCCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)