EMAIL THIS PAGE TO A FRIEND

SLC26A3

solute carrier family 26 (anion exchanger), member 3

73 Gene Product Result for
Synonyms: CLD DRA
UniProtKB ID: P40879
Gene ID:
Human(1811) Summary: The protein encoded by this gene is a transmembrane glycoprotein that transports chloride ions across the cell membrane in exchange for bicarbonate ions. It is localized to the mucosa of the lower intestinal tract, particularly to the apical membrane of columnar epithelium and some goblet cells. The protein is essential for intestinal chloride absorption, and mutations in this gene have been associated with congenital chloride diarrhea. [provided by RefSeq, Oct 2008]
Mouse(13487) solute carrier family 26, member 3
Rat(114629) solute carrier family 26 (anion exchanger), member 3
Zebrafish(563962) solute carrier family 26, member 3
Horse(100034163) solute carrier family 26, member 3
domestic cat(100169654) solute carrier family 26, member 3
chicken(417700) solute carrier family 26, member 3
dog(483261) solute carrier family 26, member 3
cow(512856) solute carrier family 26, member 3
sheep(100462650) solute carrier family 26, member 3
naked mole-rat(101701069) solute carrier family 26, member 3
Domestic Rabbit(100008798) solute carrier family 26, member 3
domestic guinea pig(100689262) solute carrier family 26, member 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000111 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000111 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000111 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_021353 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021353 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021353 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU118791 MISSION® esiRNA esiRNA human SLC26A3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000111 Rosetta Predictions human pricing
NM_053755 Rosetta Predictions rat pricing
NM_021353 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000111 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00301891 predicted 420
2 SASI_Hs01_00131534 predicted 694
3 SASI_Hs01_00131536 predicted 2237
4 SASI_Hs01_00131537 predicted 1887
5 SASI_Hs01_00131538 predicted 2518
6 SASI_Hs01_00131539 predicted 2376
7 SASI_Hs01_00131541 predicted 459
8 SASI_Hs01_00131542 predicted 2464
9 SASI_Hs01_00131543 predicted 1292
10 SASI_Hs02_00301892 predicted 1455
11 SASI_Hs01_00131535 predicted 448
12 SASI_Hs01_00131540 predicted 385
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053755 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00105743 predicted 1423
2 SASI_Rn01_00105744 predicted 585
3 SASI_Rn01_00105745 predicted 2541
4 SASI_Rn01_00105747 predicted 1191
5 SASI_Rn02_00266539 predicted 815
6 SASI_Rn01_00105748 predicted 224
7 SASI_Rn01_00105749 predicted 2426
8 SASI_Rn01_00105750 predicted 2269
9 SASI_Rn01_00105751 predicted 1429
10 SASI_Rn01_00105752 predicted 547
11 SASI_Rn01_00105746 predicted 759
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021353 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00119489 predicted 1194
2 SASI_Mm01_00119490 predicted 1790
3 SASI_Mm01_00119491 predicted 1846
4 SASI_Mm01_00119492 predicted 2273
5 SASI_Mm01_00119493 predicted 1060
6 SASI_Mm01_00119494 predicted 492
7 SASI_Mm02_00325936 predicted 2214
8 SASI_Mm01_00119495 predicted 1377
9 SASI_Mm01_00119496 predicted 1551
10 SASI_Mm02_00325937 predicted 529
11 SASI_Mm01_00119487 predicted 1779
12 SASI_Mm01_00119488 predicted 1679
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000111
SLC26A3 MISSION shRNA Bacterial Glycerol Stock
solute carrier family 26 (anion exchanger), member 3
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000430548    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000111.2-401s21c1
Sequence:CCGGTTGCCAGCATACCGGCTTAAACTCGAGTTTAAGCCGGTATGCTGGCAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413509    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000111.2-2460s21c1
Sequence:CCGGGATTACGTAATCGGGTATATGCTCGAGCATATACCCGATTACGTAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412961    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000111.2-2641s21c1
Sequence:CCGGTGGTTCTAGCATGGCATATTTCTCGAGAAATATGCCATGCTAGAACCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020179    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000111.1-772s1c1
Sequence:CCGGGCGGATTGGATTTGTAGTGATCTCGAGATCACTACAAATCCAATCCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000111.1-1257s1c1
Sequence:CCGGCCAGCGTCTATTCCCTCAAATCTCGAGATTTGAGGGAATAGACGCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000111.1-1649s1c1
Sequence:CCGGGCAGCTAGTGTGGCATTTCAACTCGAGTTGAAATGCCACACTAGCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020183    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000111.1-639s1c1
Sequence:CCGGGCAATGCAACTACTTTGGGATCTCGAGATCCCAAAGTAGTTGCATTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425986    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000111.2-1732s21c1
Sequence:CCGGATGCAGCACGCTGGCTAATATCTCGAGATATTAGCCAGCGTGCTGCATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000111
SLC26A3 MISSION shRNA shRNA Plasmid DNA
solute carrier family 26 (anion exchanger), member 3
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000430548    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000111.2-401s21c1
Sequence:CCGGTTGCCAGCATACCGGCTTAAACTCGAGTTTAAGCCGGTATGCTGGCAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413509    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000111.2-2460s21c1
Sequence:CCGGGATTACGTAATCGGGTATATGCTCGAGCATATACCCGATTACGTAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412961    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000111.2-2641s21c1
Sequence:CCGGTGGTTCTAGCATGGCATATTTCTCGAGAAATATGCCATGCTAGAACCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020179    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000111.1-772s1c1
Sequence:CCGGGCGGATTGGATTTGTAGTGATCTCGAGATCACTACAAATCCAATCCGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000111.1-1257s1c1
Sequence:CCGGCCAGCGTCTATTCCCTCAAATCTCGAGATTTGAGGGAATAGACGCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000111.1-1649s1c1
Sequence:CCGGGCAGCTAGTGTGGCATTTCAACTCGAGTTGAAATGCCACACTAGCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020183    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000111.1-639s1c1
Sequence:CCGGGCAATGCAACTACTTTGGGATCTCGAGATCCCAAAGTAGTTGCATTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425986    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000111.2-1732s21c1
Sequence:CCGGATGCAGCACGCTGGCTAATATCTCGAGATATTAGCCAGCGTGCTGCATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000111
SLC26A3 MISSION shRNA Lentiviral Transduction Particles
solute carrier family 26 (anion exchanger), member 3
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000430548    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000111.2-401s21c1
Sequence:CCGGTTGCCAGCATACCGGCTTAAACTCGAGTTTAAGCCGGTATGCTGGCAATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413509    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000111.2-2460s21c1
Sequence:CCGGGATTACGTAATCGGGTATATGCTCGAGCATATACCCGATTACGTAATCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412961    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000111.2-2641s21c1
Sequence:CCGGTGGTTCTAGCATGGCATATTTCTCGAGAAATATGCCATGCTAGAACCATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020179    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000111.1-772s1c1
Sequence:CCGGGCGGATTGGATTTGTAGTGATCTCGAGATCACTACAAATCCAATCCGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000111.1-1257s1c1
Sequence:CCGGCCAGCGTCTATTCCCTCAAATCTCGAGATTTGAGGGAATAGACGCTGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000111.1-1649s1c1
Sequence:CCGGGCAGCTAGTGTGGCATTTCAACTCGAGTTGAAATGCCACACTAGCTGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020183    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000111.1-639s1c1
Sequence:CCGGGCAATGCAACTACTTTGGGATCTCGAGATCCCAAAGTAGTTGCATTGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425986    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000111.2-1732s21c1
Sequence:CCGGATGCAGCACGCTGGCTAATATCTCGAGATATTAGCCAGCGTGCTGCATTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021353
SLC26A3 MISSION shRNA Bacterial Glycerol Stock
solute carrier family 26 (anion exchanger), member 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000069953    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021353.1-1736s1c1
Sequence:CCGGCCAATCTACTTCGCAAACATTCTCGAGAATGTTTGCGAAGTAGATTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069956    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021353.1-2167s1c1
Sequence:CCGGCGATGATGATTTCATTGACAACTCGAGTTGTCAATGAAATCATCATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069955    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021353.1-213s1c1
Sequence:CCGGCGCACAGACATCACAAGACATCTCGAGATGTCTTGTGATGTCTGTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069954    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021353.1-823s1c1
Sequence:CCGGCGACCCATTCTCTATATTCAACTCGAGTTGAATATAGAGAATGGGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069957    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021353.1-323s1c1
Sequence:CCGGCCAGCCTACAAGATAAAGGAACTCGAGTTCCTTTATCTTGTAGGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021353
SLC26A3 MISSION shRNA shRNA Plasmid DNA
solute carrier family 26 (anion exchanger), member 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000069953    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021353.1-1736s1c1
Sequence:CCGGCCAATCTACTTCGCAAACATTCTCGAGAATGTTTGCGAAGTAGATTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069956    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021353.1-2167s1c1
Sequence:CCGGCGATGATGATTTCATTGACAACTCGAGTTGTCAATGAAATCATCATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069955    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021353.1-213s1c1
Sequence:CCGGCGCACAGACATCACAAGACATCTCGAGATGTCTTGTGATGTCTGTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069954    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021353.1-823s1c1
Sequence:CCGGCGACCCATTCTCTATATTCAACTCGAGTTGAATATAGAGAATGGGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069957    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021353.1-323s1c1
Sequence:CCGGCCAGCCTACAAGATAAAGGAACTCGAGTTCCTTTATCTTGTAGGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021353
SLC26A3 MISSION shRNA Lentiviral Transduction Particles
solute carrier family 26 (anion exchanger), member 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000069953    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021353.1-1736s1c1
Sequence:CCGGCCAATCTACTTCGCAAACATTCTCGAGAATGTTTGCGAAGTAGATTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069956    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021353.1-2167s1c1
Sequence:CCGGCGATGATGATTTCATTGACAACTCGAGTTGTCAATGAAATCATCATCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069955    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021353.1-213s1c1
Sequence:CCGGCGCACAGACATCACAAGACATCTCGAGATGTCTTGTGATGTCTGTGCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069954    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021353.1-823s1c1
Sequence:CCGGCGACCCATTCTCTATATTCAACTCGAGTTGAATATAGAGAATGGGTCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069957    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021353.1-323s1c1
Sequence:CCGGCCAGCCTACAAGATAAAGGAACTCGAGTTCCTTTATCTTGTAGGCTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)