EMAIL THIS PAGE TO A FRIEND

SLC26A6

solute carrier family 26 (anion exchanger), member 6

115 Gene Product Result for
UniProtKB ID: Q9BXS9, Q96Q90, Q9NQU1
Gene ID:
Human(65010) Summary: This gene belongs to the solute carrier 26 family, whose members encode anion transporter proteins. This particular family member encodes a protein involved in transporting chloride, oxalate, sulfate and bicarbonate. Several alternatively spliced transcript variants of this gene, encoding distinct isoforms, have been described, but the full-length nature of some of these variants has not been determined. [provided by RefSeq, Jul 2008]
Mouse(171429) solute carrier family 26, member 6
Rat(301010) solute carrier family 26 (anion exchanger), member 6
domestic guinea pig(100689283) solute carrier family 26, member 6
naked mole-rat(101721623) solute carrier family 26, member 6
cow(514514) solute carrier family 26, member 6
Zebrafish(100005108) solute carrier family 26, member 6
domestic cat(101099696) solute carrier family 26, member 6
dog(608998) solute carrier family 26, member 6
chicken(416012) solute carrier family 26, member 6
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_022911 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022911 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022911 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_134420 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_134420 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_134420 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001040454 Rosetta Predictions human pricing
NM_022911 Rosetta Predictions human pricing
NM_134263 Rosetta Predictions human pricing
NM_134426 Rosetta Predictions human pricing
XM_217275 Rosetta Predictions rat pricing
NM_134420 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001040454 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00183020 predicted 2445
2 SASI_Hs01_00183022 predicted 1111
3 SASI_Hs01_00183023 predicted 1118
4 SASI_Hs01_00183025 predicted 1749
5 SASI_Hs01_00183026 predicted 806
6 SASI_Hs01_00183027 predicted 1594
7 SASI_Hs01_00183028 predicted 780
8 SASI_Hs01_00183029 predicted 559
9 SASI_Hs02_00308995 predicted 540
10 SASI_Hs02_00308996 predicted 859
11 SASI_Hs01_00183021 predicted 449
12 SASI_Hs01_00183024 predicted 2380
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022911 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00212461 predicted 2357
2 SASI_Hs01_00212463 predicted 1021
3 SASI_Hs01_00212464 predicted 1029
4 SASI_Hs01_00212466 predicted 1658
5 SASI_Hs01_00212467 predicted 716
6 SASI_Hs01_00212468 predicted 1506
7 SASI_Hs01_00212469 predicted 686
8 SASI_Hs01_00212470 predicted 475
9 SASI_Hs02_00356224 predicted 454
10 SASI_Hs02_00356225 predicted 772
11 SASI_Hs01_00212462 predicted 362
12 SASI_Hs01_00212465 predicted 2290
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_134263 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00222636 predicted 2353
2 SASI_Hs01_00222638 predicted 1020
3 SASI_Hs01_00222639 predicted 1026
4 SASI_Hs01_00222641 predicted 1661
5 SASI_Hs01_00222642 predicted 722
6 SASI_Hs01_00222643 predicted 1500
7 SASI_Hs01_00222644 predicted 689
8 SASI_Hs01_00222645 predicted 476
9 SASI_Hs02_00363302 predicted 455
10 SASI_Hs02_00363303 predicted 777
11 SASI_Hs01_00222637 predicted 362
12 SASI_Hs01_00222640 predicted 2294
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_134426 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00050662 predicted 2294
2 SASI_Hs01_00050664 predicted 1018
3 SASI_Hs01_00050665 predicted 1028
4 SASI_Hs01_00050667 predicted 1656
5 SASI_Hs01_00050668 predicted 722
6 SASI_Hs01_00050669 predicted 1501
7 SASI_Hs01_00050670 predicted 687
8 SASI_Hs01_00050671 predicted 475
9 SASI_Hs02_00363320 predicted 453
10 SASI_Hs02_00363321 predicted 774
11 SASI_Hs01_00050663 predicted 364
12 SASI_Hs01_00050666 predicted 2240
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_217275 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00170760 predicted 874
2 SASI_Rn01_00170761 predicted 2120
3 SASI_Rn01_00170762 predicted 1768
4 SASI_Rn01_00170763 predicted 1900
5 SASI_Rn01_00170764 predicted 539
6 SASI_Rn01_00170765 predicted 467
7 SASI_Rn01_00170766 predicted 390
8 SASI_Rn01_00170767 predicted 1305
9 SASI_Rn01_00170768 predicted 1873
10 SASI_Rn01_00170769 predicted 1275
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_134420 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00181972 predicted 1201
2 SASI_Mm01_00181973 predicted 1126
3 SASI_Mm01_00181974 predicted 2148
4 SASI_Mm01_00181975 predicted 1258
5 SASI_Mm01_00181976 predicted 1689
6 SASI_Mm02_00339562 predicted 857
7 SASI_Mm01_00181977 predicted 2437
8 SASI_Mm01_00181978 predicted 2840
9 SASI_Mm02_00339563 predicted 2494
10 SASI_Mm02_00339564 predicted 1805
11 SASI_Mm01_00181969 predicted 580
12 SASI_Mm01_00181970 predicted 1921
13 SASI_Mm01_00181971 predicted 2199
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022911
VALIDATED
SLC26A6 MISSION shRNA Bacterial Glycerol Stock
solute carrier family 26 (anion exchanger), member 6
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000310823    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_022911.2-2487s21c1
Sequence:CCGGGTACACACACACAACTCAGGGCTCGAGCCCTGAGTTGTGTGTGTGTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304186    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_022911.2-780s21c1
Sequence:CCGGTCGTCTCACAGCTCAAGTATGCTCGAGCATACTTGAGCTGTGAGACGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300804    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_022911.2-1972s21c1
Sequence:CCGGCGTTGAGGACTGCAAGATGATCTCGAGATCATCTTGCAGTCCTCAACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300805    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022911.2-201s21c1
Sequence:CCGGCGCTGCTGAACCAGGAGCATTCTCGAGAATGCTCCTGGTTCAGCAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304187    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022911.2-1653s21c1
Sequence:CCGGAGGTGCCAGACACGGATATTTCTCGAGAAATATCCGTGTCTGGCACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043740    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022911.2-1379s1c1
Sequence:CCGGCTCCTCATCATTGTCAAACTTCTCGAGAAGTTTGACAATGATGAGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043741    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022911.2-2266s1c1
Sequence:CCGGCGATGCATCCATCACCAAGAACTCGAGTTCTTGGTGATGGATGCATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043742    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022911.2-201s1c1
Sequence:CCGGCGCTGCTGAACCAGGAGCATTCTCGAGAATGCTCCTGGTTCAGCAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043738    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022911.2-1972s1c1
Sequence:CCGGCGTTGAGGACTGCAAGATGATCTCGAGATCATCTTGCAGTCCTCAACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043739    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022911.2-932s1c1
Sequence:CCGGGTGGTGGTGAAGCTGTTGAATCTCGAGATTCAACAGCTTCACCACCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022911
VALIDATED
SLC26A6 MISSION shRNA shRNA Plasmid DNA
solute carrier family 26 (anion exchanger), member 6
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000310823    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_022911.2-2487s21c1
Sequence:CCGGGTACACACACACAACTCAGGGCTCGAGCCCTGAGTTGTGTGTGTGTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000304186    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_022911.2-780s21c1
Sequence:CCGGTCGTCTCACAGCTCAAGTATGCTCGAGCATACTTGAGCTGTGAGACGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000300804    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_022911.2-1972s21c1
Sequence:CCGGCGTTGAGGACTGCAAGATGATCTCGAGATCATCTTGCAGTCCTCAACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000300805    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022911.2-201s21c1
Sequence:CCGGCGCTGCTGAACCAGGAGCATTCTCGAGAATGCTCCTGGTTCAGCAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000304187    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022911.2-1653s21c1
Sequence:CCGGAGGTGCCAGACACGGATATTTCTCGAGAAATATCCGTGTCTGGCACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043740    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022911.2-1379s1c1
Sequence:CCGGCTCCTCATCATTGTCAAACTTCTCGAGAAGTTTGACAATGATGAGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043741    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022911.2-2266s1c1
Sequence:CCGGCGATGCATCCATCACCAAGAACTCGAGTTCTTGGTGATGGATGCATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043742    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022911.2-201s1c1
Sequence:CCGGCGCTGCTGAACCAGGAGCATTCTCGAGAATGCTCCTGGTTCAGCAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043738    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022911.2-1972s1c1
Sequence:CCGGCGTTGAGGACTGCAAGATGATCTCGAGATCATCTTGCAGTCCTCAACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043739    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022911.2-932s1c1
Sequence:CCGGGTGGTGGTGAAGCTGTTGAATCTCGAGATTCAACAGCTTCACCACCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022911
VALIDATED
SLC26A6 MISSION shRNA Lentiviral Transduction Particles
solute carrier family 26 (anion exchanger), member 6
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000310823    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_022911.2-2487s21c1
Sequence:CCGGGTACACACACACAACTCAGGGCTCGAGCCCTGAGTTGTGTGTGTGTACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000304186    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_022911.2-780s21c1
Sequence:CCGGTCGTCTCACAGCTCAAGTATGCTCGAGCATACTTGAGCTGTGAGACGATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000300804    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_022911.2-1972s21c1
Sequence:CCGGCGTTGAGGACTGCAAGATGATCTCGAGATCATCTTGCAGTCCTCAACGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000300805    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022911.2-201s21c1
Sequence:CCGGCGCTGCTGAACCAGGAGCATTCTCGAGAATGCTCCTGGTTCAGCAGCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000304187    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022911.2-1653s21c1
Sequence:CCGGAGGTGCCAGACACGGATATTTCTCGAGAAATATCCGTGTCTGGCACCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043740    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022911.2-1379s1c1
Sequence:CCGGCTCCTCATCATTGTCAAACTTCTCGAGAAGTTTGACAATGATGAGGAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043741    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022911.2-2266s1c1
Sequence:CCGGCGATGCATCCATCACCAAGAACTCGAGTTCTTGGTGATGGATGCATCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043742    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022911.2-201s1c1
Sequence:CCGGCGCTGCTGAACCAGGAGCATTCTCGAGAATGCTCCTGGTTCAGCAGCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043738    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022911.2-1972s1c1
Sequence:CCGGCGTTGAGGACTGCAAGATGATCTCGAGATCATCTTGCAGTCCTCAACGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043739    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022911.2-932s1c1
Sequence:CCGGGTGGTGGTGAAGCTGTTGAATCTCGAGATTCAACAGCTTCACCACCACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_134420
SLC26A6 MISSION shRNA Bacterial Glycerol Stock
solute carrier family 26 (anion exchanger), member 6
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000069340    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134420.2-487s1c1
Sequence:CCGGCGTCTTCATCTACTTCCTGTTCTCGAGAACAGGAAGTAGATGAAGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069338    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134420.2-1437s1c1
Sequence:CCGGCTGTCATTATTGTGAACCTAACTCGAGTTAGGTTCACAATAATGACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069341    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134420.2-1861s1c1
Sequence:CCGGGCGAATGAAGAAAGCCAAGAACTCGAGTTCTTGGCTTTCTTCATTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069342    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134420.2-2247s1c1
Sequence:CCGGGACACTTCTTTGATGAATCTACTCGAGTAGATTCATCAAAGAAGTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069339    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134420.2-1573s1c1
Sequence:CCGGCCTGGCAGTTTCCATAGTCTTCTCGAGAAGACTATGGAAACTGCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_134420
SLC26A6 MISSION shRNA shRNA Plasmid DNA
solute carrier family 26 (anion exchanger), member 6
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000069340    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134420.2-487s1c1
Sequence:CCGGCGTCTTCATCTACTTCCTGTTCTCGAGAACAGGAAGTAGATGAAGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069338    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134420.2-1437s1c1
Sequence:CCGGCTGTCATTATTGTGAACCTAACTCGAGTTAGGTTCACAATAATGACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069341    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134420.2-1861s1c1
Sequence:CCGGGCGAATGAAGAAAGCCAAGAACTCGAGTTCTTGGCTTTCTTCATTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069342    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134420.2-2247s1c1
Sequence:CCGGGACACTTCTTTGATGAATCTACTCGAGTAGATTCATCAAAGAAGTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069339    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134420.2-1573s1c1
Sequence:CCGGCCTGGCAGTTTCCATAGTCTTCTCGAGAAGACTATGGAAACTGCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_134420
SLC26A6 MISSION shRNA Lentiviral Transduction Particles
solute carrier family 26 (anion exchanger), member 6
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000069340    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134420.2-487s1c1
Sequence:CCGGCGTCTTCATCTACTTCCTGTTCTCGAGAACAGGAAGTAGATGAAGACGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069338    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134420.2-1437s1c1
Sequence:CCGGCTGTCATTATTGTGAACCTAACTCGAGTTAGGTTCACAATAATGACAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069341    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134420.2-1861s1c1
Sequence:CCGGGCGAATGAAGAAAGCCAAGAACTCGAGTTCTTGGCTTTCTTCATTCGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069342    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134420.2-2247s1c1
Sequence:CCGGGACACTTCTTTGATGAATCTACTCGAGTAGATTCATCAAAGAAGTGTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069339    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134420.2-1573s1c1
Sequence:CCGGCCTGGCAGTTTCCATAGTCTTCTCGAGAAGACTATGGAAACTGCCAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)