EMAIL THIS PAGE TO A FRIEND

SLC28A1

solute carrier family 28 (concentrative nucleoside transporter), member 1

59 Gene Product Result for
Synonyms: CNT1 HCNT1
Gene ID:
Mouse(434203) solute carrier family 28 (sodium-coupled nucleoside transporter), member 1
Rat(116642) solute carrier family 28 (concentrative nucleoside transporter), member 1
domestic cat(101099047) solute carrier family 28 (sodium-coupled nucleoside transporter), member 1
dog(609634) solute carrier family 28 (sodium-coupled nucleoside transporter), member 1
domestic guinea pig(100726138) solute carrier family 28 (sodium-coupled nucleoside transporter), member 1
naked mole-rat(101724912) solute carrier family 28 (sodium-coupled nucleoside transporter), member 1
cow(511439) solute carrier family 28 (sodium-coupled nucleoside transporter), member 1
sheep(101109565) solute carrier family 28 (sodium-coupled nucleoside transporter), member 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004213 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004213 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004213 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001004184 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001004184 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001004184 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004213 Rosetta Predictions human pricing
NM_201651 Rosetta Predictions human pricing
NM_053863 Rosetta Predictions rat pricing
NM_001004184 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004213 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00055793 predicted 365
2 SASI_Hs02_00337122 predicted 300
3 SASI_Hs01_00055794 predicted 362
4 SASI_Hs01_00055795 predicted 364
5 SASI_Hs02_00337123 predicted 244
6 SASI_Hs01_00055796 predicted 439
7 SASI_Hs01_00055797 predicted 222
8 SASI_Hs02_00337124 predicted 425
9 SASI_Hs01_00055798 predicted 424
10 SASI_Hs01_00055799 predicted 310
11 SASI_Hs01_00055792 predicted 409
12 SASI_Hs01_00055800 predicted 411
13 SASI_Hs01_00055801 predicted 230
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_201651 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00043551 predicted 362
2 SASI_Hs02_00373155 predicted 298
3 SASI_Hs01_00043552 predicted 357
4 SASI_Hs01_00043553 predicted 363
5 SASI_Hs02_00373156 predicted 248
6 SASI_Hs01_00043554 predicted 435
7 SASI_Hs01_00043555 predicted 221
8 SASI_Hs02_00373157 predicted 419
9 SASI_Hs01_00043556 predicted 425
10 SASI_Hs01_00043557 predicted 305
11 SASI_Hs01_00043550 predicted 408
12 SASI_Hs01_00043558 predicted 410
13 SASI_Hs01_00043559 predicted 225
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053863 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00266736 predicted 705
2 SASI_Rn01_00047281 predicted 1622
3 SASI_Rn01_00047283 predicted 1135
4 SASI_Rn01_00047284 predicted 1092
5 SASI_Rn01_00047285 predicted 979
6 SASI_Rn01_00047286 predicted 676
7 SASI_Rn01_00047287 predicted 1160
8 SASI_Rn01_00047288 predicted 1631
9 SASI_Rn01_00047289 predicted 1876
10 SASI_Rn02_00266737 predicted 1326
11 SASI_Rn01_00047280 predicted 939
12 SASI_Rn01_00047282 predicted 1750
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004184 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00080433 predicted 2041
2 SASI_Mm01_00080434 predicted 766
3 SASI_Mm01_00080435 predicted 1976
4 SASI_Mm01_00080436 predicted 872
5 SASI_Mm01_00080437 predicted 1677
6 SASI_Mm02_00286510 predicted 1566
7 SASI_Mm01_00080438 predicted 1154
8 SASI_Mm01_00080439 predicted 913
9 SASI_Mm01_00080440 predicted 1172
10 SASI_Mm01_00080441 predicted 1592
11 SASI_Mm01_00080442 predicted 1015
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004213
SLC28A1 MISSION shRNA Bacterial Glycerol Stock
solute carrier family 28 (concentrative nucleoside transporter), member 1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000445973    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004213.3-1887s21c1
Sequence:CCGGAGAGCGACTTCTCCCAGATAGCTCGAGCTATCTGGGAGAAGTCGCTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004213.3-1418s1c1
Sequence:CCGGGATGCTCAGAACCTCATAGAACTCGAGTTCTATGAGGTTCTGAGCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004213.3-857s1c1
Sequence:CCGGCTCCTCGTCATCAGAACAGAACTCGAGTTCTGTTCTGATGACGAGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004213.3-1511s1c1
Sequence:CCGGGCTGTGCTGGACTTTATCAATCTCGAGATTGATAAAGTCCAGCACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004213.3-2104s1c1
Sequence:CCGGCCTGGACAACTGCTGTCGGTTCTCGAGAACCGACAGCAGTTGTCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437000    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004213.3-762s21c1
Sequence:CCGGTGTTCGTCGCTCTCCTCTTTGCTCGAGCAAAGAGGAGAGCGACGAACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043568    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004213.3-2028s1c1
Sequence:CCGGGCAGCAGTAGCTTTGAGATTTCTCGAGAAATCTCAAAGCTACTGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004213
SLC28A1 MISSION shRNA shRNA Plasmid DNA
solute carrier family 28 (concentrative nucleoside transporter), member 1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000445973    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004213.3-1887s21c1
Sequence:CCGGAGAGCGACTTCTCCCAGATAGCTCGAGCTATCTGGGAGAAGTCGCTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004213.3-1418s1c1
Sequence:CCGGGATGCTCAGAACCTCATAGAACTCGAGTTCTATGAGGTTCTGAGCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004213.3-857s1c1
Sequence:CCGGCTCCTCGTCATCAGAACAGAACTCGAGTTCTGTTCTGATGACGAGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004213.3-1511s1c1
Sequence:CCGGGCTGTGCTGGACTTTATCAATCTCGAGATTGATAAAGTCCAGCACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004213.3-2104s1c1
Sequence:CCGGCCTGGACAACTGCTGTCGGTTCTCGAGAACCGACAGCAGTTGTCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437000    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004213.3-762s21c1
Sequence:CCGGTGTTCGTCGCTCTCCTCTTTGCTCGAGCAAAGAGGAGAGCGACGAACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043568    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004213.3-2028s1c1
Sequence:CCGGGCAGCAGTAGCTTTGAGATTTCTCGAGAAATCTCAAAGCTACTGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004213
SLC28A1 MISSION shRNA Lentiviral Transduction Particles
solute carrier family 28 (concentrative nucleoside transporter), member 1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000445973    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004213.3-1887s21c1
Sequence:CCGGAGAGCGACTTCTCCCAGATAGCTCGAGCTATCTGGGAGAAGTCGCTCTTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000043570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004213.3-1418s1c1
Sequence:CCGGGATGCTCAGAACCTCATAGAACTCGAGTTCTATGAGGTTCTGAGCATCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000043569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004213.3-857s1c1
Sequence:CCGGCTCCTCGTCATCAGAACAGAACTCGAGTTCTGTTCTGATGACGAGGAGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000043571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004213.3-1511s1c1
Sequence:CCGGGCTGTGCTGGACTTTATCAATCTCGAGATTGATAAAGTCCAGCACAGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000043572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004213.3-2104s1c1
Sequence:CCGGCCTGGACAACTGCTGTCGGTTCTCGAGAACCGACAGCAGTTGTCCAGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000437000    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004213.3-762s21c1
Sequence:CCGGTGTTCGTCGCTCTCCTCTTTGCTCGAGCAAAGAGGAGAGCGACGAACATTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000043568    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004213.3-2028s1c1
Sequence:CCGGGCAGCAGTAGCTTTGAGATTTCTCGAGAAATCTCAAAGCTACTGCTGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001004184
SLC28A1 MISSION shRNA Bacterial Glycerol Stock
solute carrier family 28 (concentrative nucleoside transporter), member 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000079333    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001004184.1-2261s1c1
Sequence:CCGGCCTCTCTATTCCTCTTTCTTTCTCGAGAAAGAAAGAGGAATAGAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000079337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004184.1-1997s1c1
Sequence:CCGGACTGCACAACTGCTGTCGATTCTCGAGAATCGACAGCAGTTGTGCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000079334    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004184.1-359s1c1
Sequence:CCGGCCTGCTCTCTACTGCATACATCTCGAGATGTATGCAGTAGAGAGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000079336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004184.1-335s1c1
Sequence:CCGGGCTGTTTGAGTGGATCAGCAACTCGAGTTGCTGATCCACTCAAACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000079335    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004184.1-1086s1c1
Sequence:CCGGGCAGATATGACACTCTCTGAACTCGAGTTCAGAGAGTGTCATATCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001004184
SLC28A1 MISSION shRNA shRNA Plasmid DNA
solute carrier family 28 (concentrative nucleoside transporter), member 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000079333    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001004184.1-2261s1c1
Sequence:CCGGCCTCTCTATTCCTCTTTCTTTCTCGAGAAAGAAAGAGGAATAGAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000079337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004184.1-1997s1c1
Sequence:CCGGACTGCACAACTGCTGTCGATTCTCGAGAATCGACAGCAGTTGTGCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000079334    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004184.1-359s1c1
Sequence:CCGGCCTGCTCTCTACTGCATACATCTCGAGATGTATGCAGTAGAGAGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000079336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004184.1-335s1c1
Sequence:CCGGGCTGTTTGAGTGGATCAGCAACTCGAGTTGCTGATCCACTCAAACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000079335    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004184.1-1086s1c1
Sequence:CCGGGCAGATATGACACTCTCTGAACTCGAGTTCAGAGAGTGTCATATCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001004184
SLC28A1 MISSION shRNA Lentiviral Transduction Particles
solute carrier family 28 (concentrative nucleoside transporter), member 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000079333    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001004184.1-2261s1c1
Sequence:CCGGCCTCTCTATTCCTCTTTCTTTCTCGAGAAAGAAAGAGGAATAGAGAGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000079337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004184.1-1997s1c1
Sequence:CCGGACTGCACAACTGCTGTCGATTCTCGAGAATCGACAGCAGTTGTGCAGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000079334    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004184.1-359s1c1
Sequence:CCGGCCTGCTCTCTACTGCATACATCTCGAGATGTATGCAGTAGAGAGCAGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000079336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004184.1-335s1c1
Sequence:CCGGGCTGTTTGAGTGGATCAGCAACTCGAGTTGCTGATCCACTCAAACAGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000079335    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004184.1-1086s1c1
Sequence:CCGGGCAGATATGACACTCTCTGAACTCGAGTTCAGAGAGTGTCATATCTGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???