EMAIL THIS PAGE TO A FRIEND

SLC29A1

solute carrier family 29 (equilibrative nucleoside transporter), member 1

100 Gene Product Result for
Synonyms: ENT1
UniProtKB ID: Q99808, B3KQY5, Q5T9W9, Q9UJY2
Gene ID:
Human(2030) Summary: This gene is a member of the equilibrative nucleoside transporter family. The gene encodes a transmembrane glycoprotein that localizes to the plasma and mitochondrial membranes and mediates the cellular uptake of nucleosides from the surrounding medium. The protein is categorized as an equilibrative (as opposed to concentrative) transporter that is sensitive to inhibition by nitrobenzylthioinosine (NBMPR). Nucleoside transporters are required for nucleotide synthesis in cells that lack de novo nucleoside synthesis pathways, and are also necessary for the uptake of cytotoxic nucleosides used for cancer and viral chemotherapies. Multiple alternatively spliced variants, encoding the same protein, have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(63959) solute carrier family 29 (nucleoside transporters), member 1
Rat(63997) solute carrier family 29 (equilibrative nucleoside transporter), member 1
cow(510932) solute carrier family 29 (nucleoside transporters), member 1
sheep(101117541) solute carrier family 29 (nucleoside transporters), member 1
Goat(100861005) solute carrier family 29 (nucleoside transporters), member 1
Domestic Rabbit(100357908) solute carrier family 29 (nucleoside transporters), member 1
naked mole-rat(101701245) solute carrier family 29 (nucleoside transporters), member 1
domestic guinea pig(100730207) solute carrier family 29 (nucleoside transporters), member 1
chicken(421439) solute carrier family 29 (nucleoside transporters), member 1
Horse(100055498) solute carrier family 29 (nucleoside transporters), member 1
dog(442966) solute carrier family 29 (nucleoside transporters), member 1
domestic cat(101095579) solute carrier family 29 (nucleoside transporters), member 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Antagonist

Product # Description Species Add to Cart
 
A2169 3′-Azido-3′-deoxythymidine ≥98% (HPLC) human, mouse pricing
D9766 Dipyridamole ≥98% (HPLC) human, mouse pricing
D5412 2′-Deoxyuridine ≥98.5% mouse pricing

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
N2255 S-(4-Nitrobenzyl)-6-thioinosine ≥98%, solid human pricing

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0369 AQUA Peptide TDQSCELVIDSTE[K] mouse pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_022880 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_022880 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_022880 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004955 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004955 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004955 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU088691 MISSION® esiRNA esiRNA human SLC29A1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001078174 Rosetta Predictions human pricing
NM_001078175 Rosetta Predictions human pricing
NM_001078176 Rosetta Predictions human pricing
NM_001078177 Rosetta Predictions human pricing
NM_004955 Rosetta Predictions human pricing
NM_031684 Rosetta Predictions rat pricing
NM_022880 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001078174 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00313299 predicted 602
2 SASI_Hs02_00313300 predicted 1246
3 SASI_Hs02_00313301 predicted 1022
4 SASI_Hs02_00313302 predicted 932
5 SASI_Hs02_00313303 predicted 934
6 SASI_Hs02_00313304 predicted 1151
7 SASI_Hs02_00313305 predicted 1164
8 SASI_Hs02_00313306 predicted 576
9 SASI_Hs02_00313307 predicted 1323
10 SASI_Hs02_00313308 predicted 1110
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001078175 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00313309 predicted 514
2 SASI_Hs02_00313310 predicted 1150
3 SASI_Hs02_00313311 predicted 930
4 SASI_Hs02_00313312 predicted 841
5 SASI_Hs02_00313313 predicted 839
6 SASI_Hs02_00313314 predicted 1067
7 SASI_Hs02_00313315 predicted 1073
8 SASI_Hs02_00313316 predicted 482
9 SASI_Hs02_00313317 predicted 1236
10 SASI_Hs02_00313318 predicted 1019
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001078176 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00313319 predicted 405
2 SASI_Hs02_00313320 predicted 1050
3 SASI_Hs02_00313321 predicted 824
4 SASI_Hs02_00313322 predicted 732
5 SASI_Hs02_00313323 predicted 739
6 SASI_Hs02_00313324 predicted 952
7 SASI_Hs02_00313325 predicted 975
8 SASI_Hs02_00313326 predicted 371
9 SASI_Hs02_00313327 predicted 1123
10 SASI_Hs02_00313328 predicted 910
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001078177 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00313329 predicted 760
2 SASI_Hs02_00313330 predicted 1403
3 SASI_Hs02_00313331 predicted 1184
4 SASI_Hs02_00313332 predicted 1086
5 SASI_Hs02_00313333 predicted 1095
6 SASI_Hs02_00313334 predicted 1315
7 SASI_Hs02_00313335 predicted 1328
8 SASI_Hs02_00313336 predicted 730
9 SASI_Hs02_00313337 predicted 1483
10 SASI_Hs02_00313338 predicted 1269
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004955 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00338633 predicted 602
2 SASI_Hs02_00338634 predicted 1239
3 SASI_Hs01_00194934 predicted 1017
4 SASI_Hs01_00194933 predicted 925
5 SASI_Hs01_00194935 predicted 926
6 SASI_Hs01_00194937 predicted 1153
7 SASI_Hs01_00194938 predicted 1166
8 SASI_Hs01_00194939 predicted 568
9 SASI_Hs02_00338635 predicted 1317
10 SASI_Hs01_00194941 predicted 1105
11 SASI_Hs01_00194936 predicted 1468
12 SASI_Hs01_00194940 predicted 218
13 SASI_Hs01_00194942 predicted 612
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031684 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00033722 predicted 1650
2 SASI_Rn01_00033723 predicted 755
3 SASI_Rn01_00033724 predicted 1602
4 SASI_Rn01_00033725 predicted 1491
5 SASI_Rn01_00033726 predicted 453
6 SASI_Rn01_00033727 predicted 1053
7 SASI_Rn01_00033728 predicted 963
8 SASI_Rn01_00033729 predicted 745
9 SASI_Rn01_00033730 predicted 342
10 SASI_Rn02_00265026 predicted 1159
11 SASI_Rn01_00033721 predicted 1135
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022880 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00326662 predicted 1094
2 SASI_Mm01_00176700 predicted 1522
3 SASI_Mm01_00176701 predicted 1014
4 SASI_Mm01_00176703 predicted 934
5 SASI_Mm01_00176704 predicted 1033
6 SASI_Mm01_00176705 predicted 784
7 SASI_Mm01_00176706 predicted 616
8 SASI_Mm01_00176707 predicted 319
9 SASI_Mm01_00176708 predicted 537
10 SASI_Mm01_00176709 predicted 333
11 SASI_Mm01_00176702 predicted 1477
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022880
VALIDATED
SLC29A1 MISSION shRNA Bacterial Glycerol Stock
solute carrier family 29 (equilibrative nucleoside transporter), member 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000079725    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_022880.1-926s1c1
Sequence:CCGGGAGACCAAGTTGGATCTCATACTCGAGTATGAGATCCAACTTGGTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000079723    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_022880.1-1728s1c1
Sequence:CCGGCTTGGGATTCAGGGTCAGAATCTCGAGATTCTGACCCTGAATCCCAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000079727    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_022880.1-502s1c1
Sequence:CCGGGATCTCTCAATCTGTTCGGATCTCGAGATCCGAACAGATTGAGAGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000079724    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_022880.1-1529s1c1
Sequence:CCGGGCTGTGTTGTCCTTCTTGTTACTCGAGTAACAAGAAGGACAACACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000079726    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_022880.1-336s1c1
Sequence:CCGGCCTCGGACACTGATCAATCATCTCGAGATGATTGATCAGTGTCCGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324845    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022880.2-335s21c1
Sequence:CCGGCCTCGGACACTGATCAATCATCTCGAGATGATTGATCAGTGTCCGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324927    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022880.2-501s21c1
Sequence:CCGGGATCTCTCAATCTGTTCGGATCTCGAGATCCGAACAGATTGAGAGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324843    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022880.2-925s21c1
Sequence:CCGGGAGACCAAGTTGGATCTCATACTCGAGTATGAGATCCAACTTGGTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324844    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022880.2-1528s21c1
Sequence:CCGGGCTGTGTTGTCCTTCTTGTTACTCGAGTAACAAGAAGGACAACACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022880
VALIDATED
SLC29A1 MISSION shRNA shRNA Plasmid DNA
solute carrier family 29 (equilibrative nucleoside transporter), member 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000079725    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_022880.1-926s1c1
Sequence:CCGGGAGACCAAGTTGGATCTCATACTCGAGTATGAGATCCAACTTGGTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000079723    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_022880.1-1728s1c1
Sequence:CCGGCTTGGGATTCAGGGTCAGAATCTCGAGATTCTGACCCTGAATCCCAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000079727    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_022880.1-502s1c1
Sequence:CCGGGATCTCTCAATCTGTTCGGATCTCGAGATCCGAACAGATTGAGAGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000079724    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_022880.1-1529s1c1
Sequence:CCGGGCTGTGTTGTCCTTCTTGTTACTCGAGTAACAAGAAGGACAACACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000079726    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_022880.1-336s1c1
Sequence:CCGGCCTCGGACACTGATCAATCATCTCGAGATGATTGATCAGTGTCCGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000324845    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022880.2-335s21c1
Sequence:CCGGCCTCGGACACTGATCAATCATCTCGAGATGATTGATCAGTGTCCGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000324927    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022880.2-501s21c1
Sequence:CCGGGATCTCTCAATCTGTTCGGATCTCGAGATCCGAACAGATTGAGAGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000324843    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022880.2-925s21c1
Sequence:CCGGGAGACCAAGTTGGATCTCATACTCGAGTATGAGATCCAACTTGGTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000324844    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022880.2-1528s21c1
Sequence:CCGGGCTGTGTTGTCCTTCTTGTTACTCGAGTAACAAGAAGGACAACACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022880
VALIDATED
SLC29A1 MISSION shRNA Lentiviral Transduction Particles
solute carrier family 29 (equilibrative nucleoside transporter), member 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000079725    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_022880.1-926s1c1
Sequence:CCGGGAGACCAAGTTGGATCTCATACTCGAGTATGAGATCCAACTTGGTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000079723    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_022880.1-1728s1c1
Sequence:CCGGCTTGGGATTCAGGGTCAGAATCTCGAGATTCTGACCCTGAATCCCAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000079727    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_022880.1-502s1c1
Sequence:CCGGGATCTCTCAATCTGTTCGGATCTCGAGATCCGAACAGATTGAGAGATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000079724    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_022880.1-1529s1c1
Sequence:CCGGGCTGTGTTGTCCTTCTTGTTACTCGAGTAACAAGAAGGACAACACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000079726    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_022880.1-336s1c1
Sequence:CCGGCCTCGGACACTGATCAATCATCTCGAGATGATTGATCAGTGTCCGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324845    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022880.2-335s21c1
Sequence:CCGGCCTCGGACACTGATCAATCATCTCGAGATGATTGATCAGTGTCCGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324927    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022880.2-501s21c1
Sequence:CCGGGATCTCTCAATCTGTTCGGATCTCGAGATCCGAACAGATTGAGAGATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324843    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022880.2-925s21c1
Sequence:CCGGGAGACCAAGTTGGATCTCATACTCGAGTATGAGATCCAACTTGGTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324844    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022880.2-1528s21c1
Sequence:CCGGGCTGTGTTGTCCTTCTTGTTACTCGAGTAACAAGAAGGACAACACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004955
SLC29A1 MISSION shRNA Bacterial Glycerol Stock
solute carrier family 29 (equilibrative nucleoside transporter), member 1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000043643    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004955.1-454s1c1
Sequence:CCGGGCTGTTATTCACCTACCTCAACTCGAGTTGAGGTAGGTGAATAACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004955.1-1002s1c1
Sequence:CCGGCCACCAATGAAAGCCACTCTACTCGAGTAGAGTGGCTTTCATTGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004955.1-211s1c1
Sequence:CCGGCAAAGCTGTCTGGCTTATCTTCTCGAGAAGATAAGCCAGACAGCTTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043645    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004955.1-1354s1c1
Sequence:CCGGCGATGCCTGGTTCATCTTCTTCTCGAGAAGAAGATGAACCAGGCATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004955.1-862s1c1
Sequence:CCGGCCTGGAATTCTACCGCTACTACTCGAGTAGTAGCGGTAGAATTCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432815    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004955.2-1069s21c1
Sequence:CCGGAGACCAAGTTGGACCTCATTACTCGAGTAATGAGGTCCAACTTGGTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414276    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004955.2-768s21c1
Sequence:CCGGATCGTGCTCATTAATTCATTTCTCGAGAAATGAATTAATGAGCACGATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004955
SLC29A1 MISSION shRNA shRNA Plasmid DNA
solute carrier family 29 (equilibrative nucleoside transporter), member 1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000043643    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004955.1-454s1c1
Sequence:CCGGGCTGTTATTCACCTACCTCAACTCGAGTTGAGGTAGGTGAATAACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004955.1-1002s1c1
Sequence:CCGGCCACCAATGAAAGCCACTCTACTCGAGTAGAGTGGCTTTCATTGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004955.1-211s1c1
Sequence:CCGGCAAAGCTGTCTGGCTTATCTTCTCGAGAAGATAAGCCAGACAGCTTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043645    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004955.1-1354s1c1
Sequence:CCGGCGATGCCTGGTTCATCTTCTTCTCGAGAAGAAGATGAACCAGGCATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004955.1-862s1c1
Sequence:CCGGCCTGGAATTCTACCGCTACTACTCGAGTAGTAGCGGTAGAATTCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000432815    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004955.2-1069s21c1
Sequence:CCGGAGACCAAGTTGGACCTCATTACTCGAGTAATGAGGTCCAACTTGGTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414276    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004955.2-768s21c1
Sequence:CCGGATCGTGCTCATTAATTCATTTCTCGAGAAATGAATTAATGAGCACGATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004955
SLC29A1 MISSION shRNA Lentiviral Transduction Particles
solute carrier family 29 (equilibrative nucleoside transporter), member 1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000043643    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004955.1-454s1c1
Sequence:CCGGGCTGTTATTCACCTACCTCAACTCGAGTTGAGGTAGGTGAATAACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004955.1-1002s1c1
Sequence:CCGGCCACCAATGAAAGCCACTCTACTCGAGTAGAGTGGCTTTCATTGGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004955.1-211s1c1
Sequence:CCGGCAAAGCTGTCTGGCTTATCTTCTCGAGAAGATAAGCCAGACAGCTTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043645    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004955.1-1354s1c1
Sequence:CCGGCGATGCCTGGTTCATCTTCTTCTCGAGAAGAAGATGAACCAGGCATCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004955.1-862s1c1
Sequence:CCGGCCTGGAATTCTACCGCTACTACTCGAGTAGTAGCGGTAGAATTCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432815    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004955.2-1069s21c1
Sequence:CCGGAGACCAAGTTGGACCTCATTACTCGAGTAATGAGGTCCAACTTGGTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414276    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004955.2-768s21c1
Sequence:CCGGATCGTGCTCATTAATTCATTTCTCGAGAAATGAATTAATGAGCACGATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)