EMAIL THIS PAGE TO A FRIEND

SLC2A10

solute carrier family 2 (facilitated glucose transporter), member 10

47 Gene Product Result for
Synonyms: ATS GLUT10
UniProtKB ID: O95528, A8K4J6, Q3MIX5, Q9H4I6
Gene ID:
Human(81031) Summary: This gene encodes a member of the class III facilitative glucose transporter family. The encoded protein plays a role in regulation of glucose homeostasis. Mutations in this gene have been associated with arterial tortuosity syndrome.[provided by RefSeq, Dec 2009]
Mouse(170441) solute carrier family 2 (facilitated glucose transporter), member 10
Rat(366251) solute carrier family 2 (facilitated glucose transporter), member 10
Zebrafish(560546) solute carrier family 2 (facilitated glucose transporter), member 10
Horse(100071243) solute carrier family 2 (facilitated glucose transporter), member 10
domestic cat(101084096) solute carrier family 2 (facilitated glucose transporter), member 10
dog(485911) solute carrier family 2 (facilitated glucose transporter), member 10
chicken(419206) solute carrier family 2 (facilitated glucose transporter), member 10
domestic guinea pig(100731003) solute carrier family 2 (facilitated glucose transporter), member 10
naked mole-rat(101712204) solute carrier family 2 (facilitated glucose transporter), member 10
cow(516135) solute carrier family 2 (facilitated glucose transporter), member 10
sheep(101118547) solute carrier family 2 (facilitated glucose transporter), member 10
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Antagonist

Product # Description Species Add to Cart
 
F6886 Forskolin from Coleus forskohlii, ≥98% (HPLC), powder human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_130451 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_130451 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_130451 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_030777 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_030777 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_030777 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_030777 Rosetta Predictions human pricing
NM_001108963 Rosetta Predictions rat pricing
NM_130451 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030777 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00223713 predicted 1401
2 SASI_Hs01_00223714 predicted 1931
3 SASI_Hs01_00223715 predicted 755
4 SASI_Hs01_00223716 predicted 583
5 SASI_Hs01_00223717 predicted 1397
6 SASI_Hs02_00358319 predicted 661
7 SASI_Hs01_00223719 predicted 1450
8 SASI_Hs01_00223720 predicted 1803
9 SASI_Hs01_00223721 predicted 1184
10 SASI_Hs02_00358320 predicted 420
11 SASI_Hs01_00223718 predicted 1418
12 SASI_Hs01_00223722 predicted 1153
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108963 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00243814 predicted 309
2 SASI_Rn02_00243815 predicted 749
3 SASI_Rn02_00243816 predicted 464
4 SASI_Rn02_00243817 predicted 1370
5 SASI_Rn02_00243818 predicted 1582
6 SASI_Rn02_00243819 predicted 1575
7 SASI_Rn02_00243820 predicted 1457
8 SASI_Rn02_00243821 predicted 1005
9 SASI_Rn02_00243822 predicted 1805
10 SASI_Rn02_00243823 predicted 861
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_130451 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00131312 predicted 271
2 SASI_Mm01_00131313 predicted 426
3 SASI_Mm01_00131314 predicted 1762
4 SASI_Mm01_00131316 predicted 706
5 SASI_Mm02_00338259 predicted 1534
6 SASI_Mm01_00131317 predicted 1413
7 SASI_Mm01_00131318 predicted 1603
8 SASI_Mm01_00131319 predicted 983
9 SASI_Mm01_00131320 predicted 338
10 SASI_Mm01_00131321 predicted 982
11 SASI_Mm01_00131315 predicted 1696
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_130451
VALIDATED
SLC2A10 MISSION shRNA Bacterial Glycerol Stock
solute carrier family 2 (facilitated glucose transporter), member 10
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000322500    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130451.2-1424s21c1
Sequence:CCGGCTGGGCAGCTAACCTCTTTATCTCGAGATAAAGAGGTTAGCTGCCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322432    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_130451.2-1757s21c1
Sequence:CCGGTGAAACTCCTGATACAGATTTCTCGAGAAATCTGTATCAGGAGTTTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322430    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130451.2-826s21c1
Sequence:CCGGATTACGCCTCTACCATCTTTCCTCGAGGAAAGATGGTAGAGGCGTAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322501    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130451.2-1626s21c1
Sequence:CCGGCATAGGCAGCGCATCGGTATTCTCGAGAATACCGATGCGCTGCCTATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322431    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130451.2-980s21c1
Sequence:CCGGATGCGCTCTCATGGCCTTATCCTCGAGGATAAGGCCATGAGAGCGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000079416    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_130451.1-1530s1c1
Sequence:CCGGGCTTTCATCTACCTACTTGTTCTCGAGAACAAGTAGGTAGATGAAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000079413    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_130451.1-2526s1c1
Sequence:CCGGCCCTGGTTTATTCATCTGCAACTCGAGTTGCAGATGAATAAACCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000079417    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130451.1-426s1c1
Sequence:CCGGTGCTGTATCTACGTGTCAGAACTCGAGTTCTGACACGTAGATACAGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000079415    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_130451.1-427s1c1
Sequence:CCGGGCTGTATCTACGTGTCAGAATCTCGAGATTCTGACACGTAGATACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000079414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130451.1-1575s1c1
Sequence:CCGGGCTGAAATAGAGCAGCAGTTTCTCGAGAAACTGCTGCTCTATTTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_130451
VALIDATED
SLC2A10 MISSION shRNA shRNA Plasmid DNA
solute carrier family 2 (facilitated glucose transporter), member 10
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000322500    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130451.2-1424s21c1
Sequence:CCGGCTGGGCAGCTAACCTCTTTATCTCGAGATAAAGAGGTTAGCTGCCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322432    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_130451.2-1757s21c1
Sequence:CCGGTGAAACTCCTGATACAGATTTCTCGAGAAATCTGTATCAGGAGTTTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322430    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130451.2-826s21c1
Sequence:CCGGATTACGCCTCTACCATCTTTCCTCGAGGAAAGATGGTAGAGGCGTAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322501    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130451.2-1626s21c1
Sequence:CCGGCATAGGCAGCGCATCGGTATTCTCGAGAATACCGATGCGCTGCCTATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322431    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130451.2-980s21c1
Sequence:CCGGATGCGCTCTCATGGCCTTATCCTCGAGGATAAGGCCATGAGAGCGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000079416    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_130451.1-1530s1c1
Sequence:CCGGGCTTTCATCTACCTACTTGTTCTCGAGAACAAGTAGGTAGATGAAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000079413    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_130451.1-2526s1c1
Sequence:CCGGCCCTGGTTTATTCATCTGCAACTCGAGTTGCAGATGAATAAACCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000079417    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130451.1-426s1c1
Sequence:CCGGTGCTGTATCTACGTGTCAGAACTCGAGTTCTGACACGTAGATACAGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000079415    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_130451.1-427s1c1
Sequence:CCGGGCTGTATCTACGTGTCAGAATCTCGAGATTCTGACACGTAGATACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000079414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130451.1-1575s1c1
Sequence:CCGGGCTGAAATAGAGCAGCAGTTTCTCGAGAAACTGCTGCTCTATTTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_130451
VALIDATED
SLC2A10 MISSION shRNA Lentiviral Transduction Particles
solute carrier family 2 (facilitated glucose transporter), member 10
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000322500    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130451.2-1424s21c1
Sequence:CCGGCTGGGCAGCTAACCTCTTTATCTCGAGATAAAGAGGTTAGCTGCCCAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322432    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_130451.2-1757s21c1
Sequence:CCGGTGAAACTCCTGATACAGATTTCTCGAGAAATCTGTATCAGGAGTTTCATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322430    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130451.2-826s21c1
Sequence:CCGGATTACGCCTCTACCATCTTTCCTCGAGGAAAGATGGTAGAGGCGTAATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322501    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130451.2-1626s21c1
Sequence:CCGGCATAGGCAGCGCATCGGTATTCTCGAGAATACCGATGCGCTGCCTATGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322431    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130451.2-980s21c1
Sequence:CCGGATGCGCTCTCATGGCCTTATCCTCGAGGATAAGGCCATGAGAGCGCATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000079416    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_130451.1-1530s1c1
Sequence:CCGGGCTTTCATCTACCTACTTGTTCTCGAGAACAAGTAGGTAGATGAAAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000079413    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_130451.1-2526s1c1
Sequence:CCGGCCCTGGTTTATTCATCTGCAACTCGAGTTGCAGATGAATAAACCAGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000079417    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130451.1-426s1c1
Sequence:CCGGTGCTGTATCTACGTGTCAGAACTCGAGTTCTGACACGTAGATACAGCATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000079415    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_130451.1-427s1c1
Sequence:CCGGGCTGTATCTACGTGTCAGAATCTCGAGATTCTGACACGTAGATACAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000079414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130451.1-1575s1c1
Sequence:CCGGGCTGAAATAGAGCAGCAGTTTCTCGAGAAACTGCTGCTCTATTTCAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030777
SLC2A10 MISSION shRNA Bacterial Glycerol Stock
solute carrier family 2 (facilitated glucose transporter), member 10
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000265759    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030777.3-543s21c1
Sequence:CCGGTCTCCTATGCCCTCAACTATGCTCGAGCATAGTTGAGGGCATAGGAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256169    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030777.3-1488s21c1
Sequence:CCGGTCTCCTTCCTCGATCTCATTGCTCGAGCAATGAGATCGAGGAAGGAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265744    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030777.3-414s21c1
Sequence:CCGGCTGTGGTTGGCTTCGCCATTTCTCGAGAAATGGCGAAGCCAACCACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265768    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030777.3-3555s21c1
Sequence:CCGGCTACACATCAGGGCTTGATTTCTCGAGAAATCAAGCCCTGATGTGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030777.3-1345s1c1
Sequence:CCGGGATGGTCTTTGTCAGTGCCTTCTCGAGAAGGCACTGACAAAGACCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042839    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030777.3-449s1c1
Sequence:CCGGGCTTGCTGTATCTACGTGTCACTCGAGTGACACGTAGATACAGCAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042838    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030777.3-1563s1c1
Sequence:CCGGGCCTGGGCTTCATCTATTTATCTCGAGATAAATAGATGAAGCCCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030777.3-165s1c1
Sequence:CCGGGTTATGAACTGGCAGTCATATCTCGAGATATGACTGCCAGTTCATAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042840    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030777.3-865s1c1
Sequence:CCGGCATCTTCAGCTCCGTTGGTTTCTCGAGAAACCAACGGAGCTGAAGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030777
SLC2A10 MISSION shRNA shRNA Plasmid DNA
solute carrier family 2 (facilitated glucose transporter), member 10
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000265759    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030777.3-543s21c1
Sequence:CCGGTCTCCTATGCCCTCAACTATGCTCGAGCATAGTTGAGGGCATAGGAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256169    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030777.3-1488s21c1
Sequence:CCGGTCTCCTTCCTCGATCTCATTGCTCGAGCAATGAGATCGAGGAAGGAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000265744    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030777.3-414s21c1
Sequence:CCGGCTGTGGTTGGCTTCGCCATTTCTCGAGAAATGGCGAAGCCAACCACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000265768    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030777.3-3555s21c1
Sequence:CCGGCTACACATCAGGGCTTGATTTCTCGAGAAATCAAGCCCTGATGTGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030777.3-1345s1c1
Sequence:CCGGGATGGTCTTTGTCAGTGCCTTCTCGAGAAGGCACTGACAAAGACCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042839    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030777.3-449s1c1
Sequence:CCGGGCTTGCTGTATCTACGTGTCACTCGAGTGACACGTAGATACAGCAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042838    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030777.3-1563s1c1
Sequence:CCGGGCCTGGGCTTCATCTATTTATCTCGAGATAAATAGATGAAGCCCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030777.3-165s1c1
Sequence:CCGGGTTATGAACTGGCAGTCATATCTCGAGATATGACTGCCAGTTCATAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042840    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030777.3-865s1c1
Sequence:CCGGCATCTTCAGCTCCGTTGGTTTCTCGAGAAACCAACGGAGCTGAAGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030777
SLC2A10 MISSION shRNA Lentiviral Transduction Particles
solute carrier family 2 (facilitated glucose transporter), member 10
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000265759    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030777.3-543s21c1
Sequence:CCGGTCTCCTATGCCCTCAACTATGCTCGAGCATAGTTGAGGGCATAGGAGATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256169    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030777.3-1488s21c1
Sequence:CCGGTCTCCTTCCTCGATCTCATTGCTCGAGCAATGAGATCGAGGAAGGAGATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000265744    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030777.3-414s21c1
Sequence:CCGGCTGTGGTTGGCTTCGCCATTTCTCGAGAAATGGCGAAGCCAACCACAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000265768    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030777.3-3555s21c1
Sequence:CCGGCTACACATCAGGGCTTGATTTCTCGAGAAATCAAGCCCTGATGTGTAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030777.3-1345s1c1
Sequence:CCGGGATGGTCTTTGTCAGTGCCTTCTCGAGAAGGCACTGACAAAGACCATCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042839    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030777.3-449s1c1
Sequence:CCGGGCTTGCTGTATCTACGTGTCACTCGAGTGACACGTAGATACAGCAAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042838    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030777.3-1563s1c1
Sequence:CCGGGCCTGGGCTTCATCTATTTATCTCGAGATAAATAGATGAAGCCCAGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030777.3-165s1c1
Sequence:CCGGGTTATGAACTGGCAGTCATATCTCGAGATATGACTGCCAGTTCATAACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042840    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030777.3-865s1c1
Sequence:CCGGCATCTTCAGCTCCGTTGGTTTCTCGAGAAACCAACGGAGCTGAAGATGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)