EMAIL THIS PAGE TO A FRIEND

SLC2A13

solute carrier family 2 (facilitated glucose transporter), member 13

138 Gene Product Result for
Synonyms: HMIT
UniProtKB ID: Q96QE2, Q17S07
Gene ID:
Mouse(239606) solute carrier family 2 (facilitated glucose transporter), member 13
Rat(171147) solute carrier family 2 (facilitated glucose transporter), member 13
cow(613556) solute carrier family 2 (facilitated glucose transporter), member 13
sheep(101118936) solute carrier family 2 (facilitated glucose transporter), member 13
naked mole-rat(101705197) solute carrier family 2 (facilitated glucose transporter), member 13
domestic guinea pig(100730618) solute carrier family 2 (facilitated glucose transporter), member 13
chicken(769652) solute carrier family 2 (facilitated glucose transporter), member 13
dog(486609) solute carrier family 2 (facilitated glucose transporter), member 13
Horse(100146160) solute carrier family 2 (facilitated glucose transporter), member 13
domestic cat(101095907) solute carrier family 2 (facilitated glucose transporter), member 13
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_052885 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_052885 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_052885 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001033633 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001033633 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001033633 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU040411 MISSION® esiRNA esiRNA human SLC2A13 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_052885 Rosetta Predictions human pricing
NM_133611 Rosetta Predictions rat pricing
NM_001033633 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_052885 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00018234 predicted 917
2 SASI_Hs01_00018235 predicted 1065
3 SASI_Hs01_00018236 predicted 1880
4 SASI_Hs01_00018237 predicted 973
5 SASI_Hs01_00018238 predicted 1151
6 SASI_Hs02_00361595 predicted 1535
7 SASI_Hs01_00018240 predicted 1851
8 SASI_Hs01_00018241 predicted 1904
9 SASI_Hs01_00018243 predicted 895
10 SASI_Hs02_00361596 predicted 1320
11 SASI_Hs01_00018239 predicted 1946
12 SASI_Hs01_00018242 predicted 622
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133611 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00267837 predicted 1406
2 SASI_Rn02_00267838 predicted 731
3 SASI_Rn01_00077013 predicted 1154
4 SASI_Rn01_00077015 predicted 1750
5 SASI_Rn01_00077016 predicted 908
6 SASI_Rn01_00077017 predicted 1260
7 SASI_Rn01_00077019 predicted 798
8 SASI_Rn01_00077020 predicted 1460
9 SASI_Rn01_00077021 predicted 1269
10 SASI_Rn02_00267839 predicted 832
11 SASI_Rn01_00077014 predicted 727
12 SASI_Rn01_00077018 predicted 722
13 SASI_Rn01_00077022 predicted 1362
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033633 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00105181 predicted 2029
2 SASI_Mm01_00105182 predicted 1237
3 SASI_Mm01_00105183 predicted 2060
4 SASI_Mm02_00288951 predicted 1478
5 SASI_Mm01_00105184 predicted 2173
6 SASI_Mm01_00105185 predicted 1937
7 SASI_Mm01_00105187 predicted 778
8 SASI_Mm01_00105188 predicted 1521
9 SASI_Mm01_00105189 predicted 980
10 SASI_Mm01_00105190 predicted 1530
11 SASI_Mm01_00105186 predicted 1122
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_052885
VALIDATED
SLC2A13 MISSION shRNA Bacterial Glycerol Stock
solute carrier family 2 (facilitated glucose transporter), member 13
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000042860    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_052885.1-655s1c1
Sequence:CCGGCCCAATTTAAGAGGCCGATTACTCGAGTAATCGGCCTCTTAAATTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042858    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_052885.1-1750s1c1
Sequence:CCGGGCAGAGTATCTTACATACTATCTCGAGATAGTATGTAAGATACTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042859    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_052885.1-1019s1c1
Sequence:CCGGGCCGAGCTTTAATTGTGGGTTCTCGAGAACCCACAATTAAAGCTCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042862    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_052885.1-1151s1c1
Sequence:CCGGCTTCAGTTACAGCCTTCACAACTCGAGTTGTGAAGGCTGTAACTGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042861    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_052885.1-1358s1c1
Sequence:CCGGGCACAAGATACAGTTACTGTACTCGAGTACAGTAACTGTATCTTGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419746    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_052885.3-2345s21c1
Sequence:CCGGGTGCTAATCTAGCCAAATTACCTCGAGGTAATTTGGCTAGATTAGCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434361    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052885.3-1720s21c1
Sequence:CCGGGTCCTGGTTTCACTAACATTTCTCGAGAAATGTTAGTGAAACCAGGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414297    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_052885.3-2246s21c1
Sequence:CCGGGCCTTCCTGAAATAGTCTAAACTCGAGTTTAGACTATTTCAGGAAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430743    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052885.3-1445s21c1
Sequence:CCGGCCTCCTGTGTTCCAGTTAATACTCGAGTATTAACTGGAACACAGGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_052885
VALIDATED
SLC2A13 MISSION shRNA shRNA Plasmid DNA
solute carrier family 2 (facilitated glucose transporter), member 13
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000042860    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_052885.1-655s1c1
Sequence:CCGGCCCAATTTAAGAGGCCGATTACTCGAGTAATCGGCCTCTTAAATTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042858    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_052885.1-1750s1c1
Sequence:CCGGGCAGAGTATCTTACATACTATCTCGAGATAGTATGTAAGATACTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042859    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_052885.1-1019s1c1
Sequence:CCGGGCCGAGCTTTAATTGTGGGTTCTCGAGAACCCACAATTAAAGCTCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042862    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_052885.1-1151s1c1
Sequence:CCGGCTTCAGTTACAGCCTTCACAACTCGAGTTGTGAAGGCTGTAACTGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042861    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_052885.1-1358s1c1
Sequence:CCGGGCACAAGATACAGTTACTGTACTCGAGTACAGTAACTGTATCTTGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419746    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_052885.3-2345s21c1
Sequence:CCGGGTGCTAATCTAGCCAAATTACCTCGAGGTAATTTGGCTAGATTAGCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434361    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052885.3-1720s21c1
Sequence:CCGGGTCCTGGTTTCACTAACATTTCTCGAGAAATGTTAGTGAAACCAGGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414297    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_052885.3-2246s21c1
Sequence:CCGGGCCTTCCTGAAATAGTCTAAACTCGAGTTTAGACTATTTCAGGAAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430743    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052885.3-1445s21c1
Sequence:CCGGCCTCCTGTGTTCCAGTTAATACTCGAGTATTAACTGGAACACAGGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_052885
VALIDATED
SLC2A13 MISSION shRNA Lentiviral Transduction Particles
solute carrier family 2 (facilitated glucose transporter), member 13
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000042860    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_052885.1-655s1c1
Sequence:CCGGCCCAATTTAAGAGGCCGATTACTCGAGTAATCGGCCTCTTAAATTGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042858    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_052885.1-1750s1c1
Sequence:CCGGGCAGAGTATCTTACATACTATCTCGAGATAGTATGTAAGATACTCTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042859    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_052885.1-1019s1c1
Sequence:CCGGGCCGAGCTTTAATTGTGGGTTCTCGAGAACCCACAATTAAAGCTCGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042862    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_052885.1-1151s1c1
Sequence:CCGGCTTCAGTTACAGCCTTCACAACTCGAGTTGTGAAGGCTGTAACTGAAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042861    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_052885.1-1358s1c1
Sequence:CCGGGCACAAGATACAGTTACTGTACTCGAGTACAGTAACTGTATCTTGTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419746    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_052885.3-2345s21c1
Sequence:CCGGGTGCTAATCTAGCCAAATTACCTCGAGGTAATTTGGCTAGATTAGCACTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434361    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052885.3-1720s21c1
Sequence:CCGGGTCCTGGTTTCACTAACATTTCTCGAGAAATGTTAGTGAAACCAGGACTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414297    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_052885.3-2246s21c1
Sequence:CCGGGCCTTCCTGAAATAGTCTAAACTCGAGTTTAGACTATTTCAGGAAGGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430743    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052885.3-1445s21c1
Sequence:CCGGCCTCCTGTGTTCCAGTTAATACTCGAGTATTAACTGGAACACAGGAGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001033633
SLC2A13 MISSION shRNA Bacterial Glycerol Stock
solute carrier family 2 (facilitated glucose transporter), member 13
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000193314    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033633.1-1152s1c1
Sequence:CCGGCATCAACACTATCATGTACTACTCGAGTAGTACATGATAGTGTTGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033633.1-1939s1c1
Sequence:CCGGGAGGAAATCGAATCGCTCTTTCTCGAGAAAGAGCGATTCGATTTCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175200    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033633.1-1575s1c1
Sequence:CCGGCAGGTGTGATAATGAAACCAACTCGAGTTGGTTTCATTATCACACCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175280    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033633.1-874s1c1
Sequence:CCGGCCAGCTGTTATACAGTTTCTTCTCGAGAAGAAACTGTATAACAGCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193218    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001033633.1-2563s1c1
Sequence:CCGGCCACAAATTCAGAAGTCCTATCTCGAGATAGGACTTCTGAATTTGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193537    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001033633.1-5066s1c1
Sequence:CCGGGCACAGAATTTATGGATCTTTCTCGAGAAAGATCCATAAATTCTGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001033633
SLC2A13 MISSION shRNA shRNA Plasmid DNA
solute carrier family 2 (facilitated glucose transporter), member 13
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000193314    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033633.1-1152s1c1
Sequence:CCGGCATCAACACTATCATGTACTACTCGAGTAGTACATGATAGTGTTGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033633.1-1939s1c1
Sequence:CCGGGAGGAAATCGAATCGCTCTTTCTCGAGAAAGAGCGATTCGATTTCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175200    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033633.1-1575s1c1
Sequence:CCGGCAGGTGTGATAATGAAACCAACTCGAGTTGGTTTCATTATCACACCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175280    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033633.1-874s1c1
Sequence:CCGGCCAGCTGTTATACAGTTTCTTCTCGAGAAGAAACTGTATAACAGCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193218    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001033633.1-2563s1c1
Sequence:CCGGCCACAAATTCAGAAGTCCTATCTCGAGATAGGACTTCTGAATTTGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193537    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001033633.1-5066s1c1
Sequence:CCGGGCACAGAATTTATGGATCTTTCTCGAGAAAGATCCATAAATTCTGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001033633
SLC2A13 MISSION shRNA Lentiviral Transduction Particles
solute carrier family 2 (facilitated glucose transporter), member 13
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000193314    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033633.1-1152s1c1
Sequence:CCGGCATCAACACTATCATGTACTACTCGAGTAGTACATGATAGTGTTGATGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033633.1-1939s1c1
Sequence:CCGGGAGGAAATCGAATCGCTCTTTCTCGAGAAAGAGCGATTCGATTTCCTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175200    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033633.1-1575s1c1
Sequence:CCGGCAGGTGTGATAATGAAACCAACTCGAGTTGGTTTCATTATCACACCTGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175280    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033633.1-874s1c1
Sequence:CCGGCCAGCTGTTATACAGTTTCTTCTCGAGAAGAAACTGTATAACAGCTGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193218    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001033633.1-2563s1c1
Sequence:CCGGCCACAAATTCAGAAGTCCTATCTCGAGATAGGACTTCTGAATTTGTGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193537    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001033633.1-5066s1c1
Sequence:CCGGGCACAGAATTTATGGATCTTTCTCGAGAAAGATCCATAAATTCTGTGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)