EMAIL THIS PAGE TO A FRIEND

SLC2A2

solute carrier family 2 (facilitated glucose transporter), member 2

48 Gene Product Result for
Synonyms: GLUT2
UniProtKB ID: P11168, A8K481, B2R936, Q9UCW9
Gene ID:
Human(6514) Summary: This gene encodes an integral plasma membrane glycoprotein of the liver, islet beta cells, intestine, and kidney epithelium. The encoded protein mediates facilitated bidirectional glucose transport. Because of its low affinity for glucose, it has been suggested as a glucose sensor. Mutations in this gene are associated with susceptibility to diseases, including Fanconi-Bickel syndrome and noninsulin-dependent diabetes mellitus (NIDDM). Alternative splicing results in multiple transcript variants of this gene. [provided by RefSeq, Jul 2013]
Mouse(20526) solute carrier family 2 (facilitated glucose transporter), member 2
Rat(25351) solute carrier family 2 (facilitated glucose transporter), member 2
Zebrafish(322493) solute carrier family 2 (facilitated glucose transporter), member 2
chicken(396272) solute carrier family 2 (facilitated glucose transporter), member 2
dog(488165) solute carrier family 2 (facilitated glucose transporter), member 2
domestic cat(100142681) solute carrier family 2 (facilitated glucose transporter), member 2
Horse(100033974) solute carrier family 2 (facilitated glucose transporter), member 2
cow(282357) solute carrier family 2 (facilitated glucose transporter), member 2
sheep(443205) solute carrier family 2 (facilitated glucose transporter), member 2
domestic guinea pig(100733937) solute carrier family 2 (facilitated glucose transporter), member 2
naked mole-rat(101699012) solute carrier family 2 (facilitated glucose transporter), member 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_031197 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_031197 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_031197 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000340 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000340 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000340 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU144201 MISSION® esiRNA targeting human SLC2A2 human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000340 Rosetta Predictions human pricing
NM_012879 Rosetta Predictions rat pricing
NM_031197 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000340 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00212041 predicted 1109
2 SASI_Hs01_00212043 predicted 925
3 SASI_Hs01_00212044 predicted 466
4 SASI_Hs01_00212045 predicted 678
5 SASI_Hs02_00302368 predicted 942
6 SASI_Hs01_00212046 predicted 1208
7 SASI_Hs02_00302369 predicted 1330
8 SASI_Hs01_00212048 predicted 493
9 SASI_Hs02_00302370 predicted 1429
10 SASI_Hs01_00212049 predicted 1170
11 SASI_Hs01_00212042 predicted 378
12 SASI_Hs01_00212047 predicted 1314
13 SASI_Hs01_00212050 predicted 796
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012879 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00093759 predicted 904
2 SASI_Rn01_00093760 predicted 1281
3 SASI_Rn01_00093761 predicted 919
4 SASI_Rn01_00093762 predicted 505
5 SASI_Rn01_00093764 predicted 409
6 SASI_Rn01_00093763 predicted 692
7 SASI_Rn01_00093765 predicted 1277
8 SASI_Rn01_00093766 predicted 646
9 SASI_Rn01_00093767 predicted 193
10 SASI_Rn01_00093768 predicted 549
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031197 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00337051 predicted 373
2 SASI_Mm02_00337052 predicted 1772
3 SASI_Mm02_00337053 predicted 463
4 SASI_Mm02_00337054 predicted 594
5 SASI_Mm02_00337055 predicted 1528
6 SASI_Mm02_00337056 predicted 899
7 SASI_Mm02_00337057 predicted 1362
8 SASI_Mm02_00337058 predicted 734
9 SASI_Mm02_00337059 predicted 770
10 SASI_Mm02_00337060 predicted 530
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031197
SLC2A2 MISSION shRNA Bacterial Glycerol Stock
solute carrier family 2 (facilitated glucose transporter), member 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000079346    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031197.1-533s1c1
Sequence:CCGGGAAGTGTATCAGGACTGTATTCTCGAGAATACAGTCCTGATACACTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000079343    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031197.1-2311s1c1
Sequence:CCGGGCTCAGATTATCAGTTAGTTACTCGAGTAACTAACTGATAATCTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000079347    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031197.1-681s1c1
Sequence:CCGGCCTCAGCTTTATTCTGGGCAACTCGAGTTGCCCAGAATAAAGCTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000079344    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031197.1-1227s1c1
Sequence:CCGGGCTGGATAAATTCGCCTGGATCTCGAGATCCAGGCGAATTTATCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000079345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031197.1-160s1c1
Sequence:CCGGGCACCTCAAGAGGTAATAATACTCGAGTATTATTACCTCTTGAGGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031197
SLC2A2 MISSION shRNA shRNA Plasmid DNA
solute carrier family 2 (facilitated glucose transporter), member 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000079346    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031197.1-533s1c1
Sequence:CCGGGAAGTGTATCAGGACTGTATTCTCGAGAATACAGTCCTGATACACTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000079343    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031197.1-2311s1c1
Sequence:CCGGGCTCAGATTATCAGTTAGTTACTCGAGTAACTAACTGATAATCTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000079347    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031197.1-681s1c1
Sequence:CCGGCCTCAGCTTTATTCTGGGCAACTCGAGTTGCCCAGAATAAAGCTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000079344    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031197.1-1227s1c1
Sequence:CCGGGCTGGATAAATTCGCCTGGATCTCGAGATCCAGGCGAATTTATCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000079345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031197.1-160s1c1
Sequence:CCGGGCACCTCAAGAGGTAATAATACTCGAGTATTATTACCTCTTGAGGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031197
SLC2A2 MISSION shRNA Lentiviral Transduction Particles
solute carrier family 2 (facilitated glucose transporter), member 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000079346    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031197.1-533s1c1
Sequence:CCGGGAAGTGTATCAGGACTGTATTCTCGAGAATACAGTCCTGATACACTTCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000079343    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031197.1-2311s1c1
Sequence:CCGGGCTCAGATTATCAGTTAGTTACTCGAGTAACTAACTGATAATCTGAGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000079347    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031197.1-681s1c1
Sequence:CCGGCCTCAGCTTTATTCTGGGCAACTCGAGTTGCCCAGAATAAAGCTGAGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000079344    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031197.1-1227s1c1
Sequence:CCGGGCTGGATAAATTCGCCTGGATCTCGAGATCCAGGCGAATTTATCCAGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000079345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031197.1-160s1c1
Sequence:CCGGGCACCTCAAGAGGTAATAATACTCGAGTATTATTACCTCTTGAGGTGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000340
SLC2A2 MISSION shRNA Bacterial Glycerol Stock
solute carrier family 2 (facilitated glucose transporter), member 2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000043598    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000340.1-510s1c1
Sequence:CCGGGCCCACAATCTCATACTCAATCTCGAGATTGAGTATGAGATTGTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000340.1-700s1c1
Sequence:CCGGGCAAACATTCTGTCATTAGTTCTCGAGAACTAATGACAGAATGTTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043602    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000340.1-406s1c1
Sequence:CCGGGCACCTCAACAGGTAATAATACTCGAGTATTATTACCTGTTGAGGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000340.1-1402s1c1
Sequence:CCGGCGACGTTCTCTCTTTCTAATTCTCGAGAATTAGAAAGAGAGAACGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000340.1-1476s1c1
Sequence:CCGGGCTGAATAAGTTCTCTTGGATCTCGAGATCCAAGAGAACTTATTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423990    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000340.1-894s21c1
Sequence:CCGGCATCGTCACGGGCATTCTTATCTCGAGATAAGAATGCCCGTGACGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438530    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000340.1-1681s21c1
Sequence:CCGGGCGGACTTCTGTGGACCTTATCTCGAGATAAGGTCCACAGAAGTCCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423119    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000340.1-1111s21c1
Sequence:CCGGGATGTCACCAAAGATATTAATCTCGAGATTAATATCTTTGGTGACATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000340
SLC2A2 MISSION shRNA shRNA Plasmid DNA
solute carrier family 2 (facilitated glucose transporter), member 2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000043598    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000340.1-510s1c1
Sequence:CCGGGCCCACAATCTCATACTCAATCTCGAGATTGAGTATGAGATTGTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000340.1-700s1c1
Sequence:CCGGGCAAACATTCTGTCATTAGTTCTCGAGAACTAATGACAGAATGTTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043602    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000340.1-406s1c1
Sequence:CCGGGCACCTCAACAGGTAATAATACTCGAGTATTATTACCTGTTGAGGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000340.1-1402s1c1
Sequence:CCGGCGACGTTCTCTCTTTCTAATTCTCGAGAATTAGAAAGAGAGAACGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000340.1-1476s1c1
Sequence:CCGGGCTGAATAAGTTCTCTTGGATCTCGAGATCCAAGAGAACTTATTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423990    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000340.1-894s21c1
Sequence:CCGGCATCGTCACGGGCATTCTTATCTCGAGATAAGAATGCCCGTGACGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000438530    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000340.1-1681s21c1
Sequence:CCGGGCGGACTTCTGTGGACCTTATCTCGAGATAAGGTCCACAGAAGTCCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423119    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000340.1-1111s21c1
Sequence:CCGGGATGTCACCAAAGATATTAATCTCGAGATTAATATCTTTGGTGACATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000340
SLC2A2 MISSION shRNA Lentiviral Transduction Particles
solute carrier family 2 (facilitated glucose transporter), member 2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000043598    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000340.1-510s1c1
Sequence:CCGGGCCCACAATCTCATACTCAATCTCGAGATTGAGTATGAGATTGTGGGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000043600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000340.1-700s1c1
Sequence:CCGGGCAAACATTCTGTCATTAGTTCTCGAGAACTAATGACAGAATGTTTGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000043602    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000340.1-406s1c1
Sequence:CCGGGCACCTCAACAGGTAATAATACTCGAGTATTATTACCTGTTGAGGTGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000043601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000340.1-1402s1c1
Sequence:CCGGCGACGTTCTCTCTTTCTAATTCTCGAGAATTAGAAAGAGAGAACGTCGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000043599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000340.1-1476s1c1
Sequence:CCGGGCTGAATAAGTTCTCTTGGATCTCGAGATCCAAGAGAACTTATTCAGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000423990    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000340.1-894s21c1
Sequence:CCGGCATCGTCACGGGCATTCTTATCTCGAGATAAGAATGCCCGTGACGATGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000438530    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000340.1-1681s21c1
Sequence:CCGGGCGGACTTCTGTGGACCTTATCTCGAGATAAGGTCCACAGAAGTCCGCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000423119    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000340.1-1111s21c1
Sequence:CCGGGATGTCACCAAAGATATTAATCTCGAGATTAATATCTTTGGTGACATCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???