EMAIL THIS PAGE TO A FRIEND

SLC2A4

solute carrier family 2 (facilitated glucose transporter), member 4

75 Gene Product Result for
Synonyms: GLUT4
UniProtKB ID: P14672, Q14CX2
Gene ID:
Human(6517) Summary: This gene is a member of the solute carrier family 2 (facilitated glucose transporter) family and encodes a protein that functions as an insulin-regulated facilitative glucose transporter. In the absence of insulin, this integral membrane protein is sequestered within the cells of muscle and adipose tissue. Within minutes of insulin stimulation, the protein moves to the cell surface and begins to transport glucose across the cell membrane. Mutations in this gene have been associated with noninsulin-dependent diabetes mellitus (NIDDM). [provided by RefSeq, Jul 2008]
Mouse(20528) solute carrier family 2 (facilitated glucose transporter), member 4
Rat(25139) solute carrier family 2 (facilitated glucose transporter), member 4
Horse(100033939) solute carrier family 2 (facilitated glucose transporter), member 4
domestic cat(100127021) solute carrier family 2 (facilitated glucose transporter), member 4
dog(403673) solute carrier family 2 (facilitated glucose transporter), member 4
domestic cat(101095139) solute carrier family 2 (facilitated glucose transporter), member 4
cow(282359) solute carrier family 2 (facilitated glucose transporter), member 4
Goat(100860891) solute carrier family 2 (facilitated glucose transporter), member 4
sheep(101118797) solute carrier family 2 (facilitated glucose transporter), member 4
domestic guinea pig(100716624) solute carrier family 2 (facilitated glucose transporter), member 4
Domestic Rabbit(100037710) solute carrier family 2 (facilitated glucose transporter), member 4
naked mole-rat(101714675) solute carrier family 2 (facilitated glucose transporter), member 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
CBL243 Anti-Glucose Transporter GLUT-4 Antibody clone, Chemicon®, from rabbit human, mouse, rat
immunoprecipitation (IP), western blot pricing
07-1404 Anti-GLUT-4 Antibody, C-terminus clone, from rabbit, purified by affinity chromatography mouse, mouse, human, human
immunohistochemistry, western blot pricing
G4048 Anti-GLUT4 (C-terminal) antibody produced in rabbit ~1.5 mg/mL, affinity isolated antibody, buffered aqueous solution human, mouse
immunofluorescence, western blot pricing
G4173 Anti-GLUT4 antibody produced in rabbit 1.5 mg/mL, affinity isolated antibody, buffered aqueous solution mouse, human
immunofluorescence, western blot pricing
SAB2501472 Anti-SLC2A4 (C-terminal) antibody produced in goat affinity isolated antibody, buffered aqueous solution bovine, mouse, rat, human
ELISA, immunohistochemistry, western blot pricing
SAB4300667 Anti-SLC2A4 antibody produced in rabbit affinity isolated antibody human, mouse, rat
western blot pricing
SAB2108222 Anti-SLC2A4 antibody produced in rabbit affinity isolated antibody guinea pig, goat, rabbit, human, rat, bovine, dog, horse
western blot pricing
SAB4200653 Monoclonal Anti-GLUT4/SLC2A4 antibody produced in mouse clone Glut2.6, purified from hybridoma cell culture human
immunofluorescence, western blot pricing
WH0006517M8 Monoclonal Anti-SLC2A4 antibody produced in mouse clone 2D6, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1404374 Monoclonal Anti-SLC2A4, (C-terminal) antibody produced in mouse clone 1F12, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
C1172 ML-9 ≥99% (TLC), powder human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001042 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001042 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001042 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009204 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009204 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009204 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001042 Rosetta Predictions human pricing
NM_012751 Rosetta Predictions rat pricing
NM_009204 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00309185 predicted 569
2 SASI_Hs02_00309186 predicted 1590
3 SASI_Hs01_00123600 predicted 479
4 SASI_Hs02_00309187 predicted 498
5 SASI_Hs01_00123602 predicted 731
6 SASI_Hs01_00123603 predicted 1266
7 SASI_Hs01_00123604 predicted 1201
8 SASI_Hs01_00123605 predicted 1009
9 SASI_Hs01_00123606 predicted 720
10 SASI_Hs01_00123607 predicted 579
11 SASI_Hs01_00123599 predicted 1340
12 SASI_Hs01_00123601 predicted 1469
13 SASI_Hs01_00123608 predicted 1474
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012751 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00094541 predicted 603
2 SASI_Rn01_00094542 predicted 474
3 SASI_Rn01_00094543 predicted 534
4 SASI_Rn01_00094544 predicted 1625
5 SASI_Rn01_00094546 predicted 579
6 SASI_Rn01_00094547 predicted 290
7 SASI_Rn02_00260111 predicted 239
8 SASI_Rn01_00094549 predicted 294
9 SASI_Rn01_00094550 predicted 934
10 SASI_Rn02_00260112 predicted 662
11 SASI_Rn01_00094545 predicted 1535
12 SASI_Rn01_00094548 predicted 284
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009204 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00032134 predicted 270
2 SASI_Mm01_00032135 predicted 546
3 SASI_Mm01_00032136 predicted 604
4 SASI_Mm01_00032137 predicted 1536
5 SASI_Mm01_00032138 predicted 1626
6 SASI_Mm01_00032139 predicted 352
7 SASI_Mm01_00032140 predicted 1698
8 SASI_Mm01_00032141 predicted 1812
9 SASI_Mm01_00032142 predicted 854
10 SASI_Mm01_00032143 predicted 645
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001042
SLC2A4 MISSION shRNA Bacterial Glycerol Stock
solute carrier family 2 (facilitated glucose transporter), member 4
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000043628    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001042.1-1483s1c1
Sequence:CCGGGCCCTACGTCTTCCTTCTATTCTCGAGAATAGAAGGAAGACGTAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043629    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001042.1-1536s1c1
Sequence:CCGGCCTTCTTAAGAGTACCTGAAACTCGAGTTTCAGGTACTCTTAAGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001042.1-296s1c1
Sequence:CCGGGTGATTGAACAGAGCTACAATCTCGAGATTGTAGCTCTGTTCAATCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438137    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042.2-1515s21c1
Sequence:CCGGCAGTATGTTGCGGAGGCTATGCTCGAGCATAGCCTCCGCAACATACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425043    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001042.2-2123s21c1
Sequence:CCGGGGAGACAAGAAATCCAGTTTCCTCGAGGAAACTGGATTTCTTGTCTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001042.1-430s1c1
Sequence:CCGGCTCCTTCCTCATTGGTATCATCTCGAGATGATACCAATGAGGAAGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043630    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001042.1-1643s1c1
Sequence:CCGGCTTGAGTATTTAGGGCCAGATCTCGAGATCTGGCCCTAAATACTCAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425084    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042.2-1483s21c1
Sequence:CCGGGGACGAGCAACTTCATCATTGCTCGAGCAATGATGAAGTTGCTCGTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001042
SLC2A4 MISSION shRNA shRNA Plasmid DNA
solute carrier family 2 (facilitated glucose transporter), member 4
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000043628    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001042.1-1483s1c1
Sequence:CCGGGCCCTACGTCTTCCTTCTATTCTCGAGAATAGAAGGAAGACGTAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043629    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001042.1-1536s1c1
Sequence:CCGGCCTTCTTAAGAGTACCTGAAACTCGAGTTTCAGGTACTCTTAAGAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001042.1-296s1c1
Sequence:CCGGGTGATTGAACAGAGCTACAATCTCGAGATTGTAGCTCTGTTCAATCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000438137    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042.2-1515s21c1
Sequence:CCGGCAGTATGTTGCGGAGGCTATGCTCGAGCATAGCCTCCGCAACATACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425043    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001042.2-2123s21c1
Sequence:CCGGGGAGACAAGAAATCCAGTTTCCTCGAGGAAACTGGATTTCTTGTCTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001042.1-430s1c1
Sequence:CCGGCTCCTTCCTCATTGGTATCATCTCGAGATGATACCAATGAGGAAGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043630    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001042.1-1643s1c1
Sequence:CCGGCTTGAGTATTTAGGGCCAGATCTCGAGATCTGGCCCTAAATACTCAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425084    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042.2-1483s21c1
Sequence:CCGGGGACGAGCAACTTCATCATTGCTCGAGCAATGATGAAGTTGCTCGTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001042
SLC2A4 MISSION shRNA Lentiviral Transduction Particles
solute carrier family 2 (facilitated glucose transporter), member 4
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000043628    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001042.1-1483s1c1
Sequence:CCGGGCCCTACGTCTTCCTTCTATTCTCGAGAATAGAAGGAAGACGTAGGGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000043629    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001042.1-1536s1c1
Sequence:CCGGCCTTCTTAAGAGTACCTGAAACTCGAGTTTCAGGTACTCTTAAGAAGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000043632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001042.1-296s1c1
Sequence:CCGGGTGATTGAACAGAGCTACAATCTCGAGATTGTAGCTCTGTTCAATCACTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000438137    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042.2-1515s21c1
Sequence:CCGGCAGTATGTTGCGGAGGCTATGCTCGAGCATAGCCTCCGCAACATACTGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000425043    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001042.2-2123s21c1
Sequence:CCGGGGAGACAAGAAATCCAGTTTCCTCGAGGAAACTGGATTTCTTGTCTCCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000043631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001042.1-430s1c1
Sequence:CCGGCTCCTTCCTCATTGGTATCATCTCGAGATGATACCAATGAGGAAGGAGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000043630    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001042.1-1643s1c1
Sequence:CCGGCTTGAGTATTTAGGGCCAGATCTCGAGATCTGGCCCTAAATACTCAAGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000425084    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042.2-1483s21c1
Sequence:CCGGGGACGAGCAACTTCATCATTGCTCGAGCAATGATGAAGTTGCTCGTCCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009204
VALIDATED
SLC2A4 MISSION shRNA Bacterial Glycerol Stock
solute carrier family 2 (facilitated glucose transporter), member 4
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000257260    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009204.2-1357s21c1
Sequence:CCGGTCTCCATCGTGGCCATATTTGCTCGAGCAAATATGGCCACGATGGAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000079369    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009204.1-260s1c1
Sequence:CCGGGCTCCCTTCAGTTTGGCTATACTCGAGTATAGCCAAACTGAAGGGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000079368    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009204.1-2002s1c1
Sequence:CCGGCCCTGAATTCATCAGGATAAACTCGAGTTTATCCTGATGAATTCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000079372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009204.1-435s1c1
Sequence:CCGGCATGATCTCTTCCTTTCTCATCTCGAGATGAGAAAGGAAGAGATCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000079370    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009204.1-1470s1c1
Sequence:CCGGCCAGTATGTTGCGGATCGTATCTCGAGATACGATCCGCAACATACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000079371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009204.1-456s1c1
Sequence:CCGGTGGCATCATTTCTCAATGGTTCTCGAGAACCATTGAGAAATGATGCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000225808    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009204.2-2390s21c1
Sequence:CCGGGAAAGCTTCTGACCAACTAAGCTCGAGCTTAGTTGGTCAGAAGCTTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218223    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009204.2-361s21c1
Sequence:GTACCGGTGATTGAACAGAGCTACAATGCTCGAGCATTGTAGCTCTGTTCAATCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000225806    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009204.2-736s21c1
Sequence:CCGGACCAACTGGCCATCGTCATTGCTCGAGCAATGACGATGGCCAGTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000225807    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009204.2-1549s21c1
Sequence:CCGGCTTACGTCTTCCTTCTATTTGCTCGAGCAAATAGAAGGAAGACGTAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009204
VALIDATED
SLC2A4 MISSION shRNA shRNA Plasmid DNA
solute carrier family 2 (facilitated glucose transporter), member 4
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000257260    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009204.2-1357s21c1
Sequence:CCGGTCTCCATCGTGGCCATATTTGCTCGAGCAAATATGGCCACGATGGAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000079369    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009204.1-260s1c1
Sequence:CCGGGCTCCCTTCAGTTTGGCTATACTCGAGTATAGCCAAACTGAAGGGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000079368    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009204.1-2002s1c1
Sequence:CCGGCCCTGAATTCATCAGGATAAACTCGAGTTTATCCTGATGAATTCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000079372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009204.1-435s1c1
Sequence:CCGGCATGATCTCTTCCTTTCTCATCTCGAGATGAGAAAGGAAGAGATCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000079370    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009204.1-1470s1c1
Sequence:CCGGCCAGTATGTTGCGGATCGTATCTCGAGATACGATCCGCAACATACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000079371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009204.1-456s1c1
Sequence:CCGGTGGCATCATTTCTCAATGGTTCTCGAGAACCATTGAGAAATGATGCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000225808    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009204.2-2390s21c1
Sequence:CCGGGAAAGCTTCTGACCAACTAAGCTCGAGCTTAGTTGGTCAGAAGCTTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218223    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009204.2-361s21c1
Sequence:GTACCGGTGATTGAACAGAGCTACAATGCTCGAGCATTGTAGCTCTGTTCAATCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000225806    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009204.2-736s21c1
Sequence:CCGGACCAACTGGCCATCGTCATTGCTCGAGCAATGACGATGGCCAGTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000225807    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009204.2-1549s21c1
Sequence:CCGGCTTACGTCTTCCTTCTATTTGCTCGAGCAAATAGAAGGAAGACGTAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009204
VALIDATED
SLC2A4 MISSION shRNA Lentiviral Transduction Particles
solute carrier family 2 (facilitated glucose transporter), member 4
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000257260    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009204.2-1357s21c1
Sequence:CCGGTCTCCATCGTGGCCATATTTGCTCGAGCAAATATGGCCACGATGGAGATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000079369    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009204.1-260s1c1
Sequence:CCGGGCTCCCTTCAGTTTGGCTATACTCGAGTATAGCCAAACTGAAGGGAGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000079368    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009204.1-2002s1c1
Sequence:CCGGCCCTGAATTCATCAGGATAAACTCGAGTTTATCCTGATGAATTCAGGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000079372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009204.1-435s1c1
Sequence:CCGGCATGATCTCTTCCTTTCTCATCTCGAGATGAGAAAGGAAGAGATCATGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000079370    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009204.1-1470s1c1
Sequence:CCGGCCAGTATGTTGCGGATCGTATCTCGAGATACGATCCGCAACATACTGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000079371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009204.1-456s1c1
Sequence:CCGGTGGCATCATTTCTCAATGGTTCTCGAGAACCATTGAGAAATGATGCCATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000225808    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009204.2-2390s21c1
Sequence:CCGGGAAAGCTTCTGACCAACTAAGCTCGAGCTTAGTTGGTCAGAAGCTTTCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000218223    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009204.2-361s21c1
Sequence:GTACCGGTGATTGAACAGAGCTACAATGCTCGAGCATTGTAGCTCTGTTCAATCATTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000225806    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009204.2-736s21c1
Sequence:CCGGACCAACTGGCCATCGTCATTGCTCGAGCAATGACGATGGCCAGTTGGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000225807    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009204.2-1549s21c1
Sequence:CCGGCTTACGTCTTCCTTCTATTTGCTCGAGCAAATAGAAGGAAGACGTAAGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???