EMAIL THIS PAGE TO A FRIEND

SLC2A9

solute carrier family 2 (facilitated glucose transporter), member 9

116 Gene Product Result for
Synonyms: GLUT9 GLUTX UAQTL2 URATv1
UniProtKB ID: Q9NRM0, Q0VGC4, Q4W5D1, Q8WV30, Q96P00
Gene ID:
Human(56606) Summary: This gene encodes a member of the SLC2A facilitative glucose transporter family. Members of this family play a significant role in maintaining glucose homeostasis. The encoded protein may play a role in the development and survival of chondrocytes in cartilage matrices. Two transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
Mouse(117591) solute carrier family 2 (facilitated glucose transporter), member 9
Rat(501925) solute carrier family 2 (facilitated glucose transporter), member 9
cow(100337051) solute carrier family 2 (facilitated glucose transporter), member 9
sheep(101104402) solute carrier family 2 (facilitated glucose transporter), member 9
domestic guinea pig(100728307) solute carrier family 2 (facilitated glucose transporter), member 9
naked mole-rat(101702304) solute carrier family 2 (facilitated glucose transporter), member 9
chicken(422843) solute carrier family 2 (facilitated glucose transporter), member 9
Horse(100056219) solute carrier family 2 (facilitated glucose transporter), member 9
dog(479093) solute carrier family 2 (facilitated glucose transporter), member 9
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001001290 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001001290 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001001290 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_145559 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145559 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145559 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU070431 MISSION® esiRNA esiRNA human SLC2A9 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001001290 Rosetta Predictions human pricing
NM_020041 Rosetta Predictions human pricing
XM_001062303 Rosetta Predictions rat pricing
XM_577349 Rosetta Predictions rat pricing
NM_001012363 Rosetta Predictions mouse pricing
NM_001102414 Rosetta Predictions mouse pricing
NM_001102415 Rosetta Predictions mouse pricing
NM_145559 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001290 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00044955 predicted 1064
2 SASI_Hs01_00044957 predicted 1179
3 SASI_Hs01_00044958 predicted 1514
4 SASI_Hs02_00303710 predicted 1069
5 SASI_Hs02_00303711 predicted 496
6 SASI_Hs01_00044959 predicted 1542
7 SASI_Hs01_00044960 predicted 484
8 SASI_Hs01_00044961 predicted 1113
9 SASI_Hs01_00044962 predicted 1065
10 SASI_Hs01_00044963 predicted 887
11 SASI_Hs01_00044954 predicted 494
12 SASI_Hs01_00044956 predicted 1594
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020041 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00160073 predicted 1056
2 SASI_Hs01_00160075 predicted 1164
3 SASI_Hs01_00160076 predicted 1498
4 SASI_Hs02_00352947 predicted 1058
5 SASI_Hs02_00352948 predicted 483
6 SASI_Hs01_00160077 predicted 1528
7 SASI_Hs01_00160078 predicted 476
8 SASI_Hs01_00160079 predicted 1102
9 SASI_Hs01_00160080 predicted 1050
10 SASI_Hs01_00160081 predicted 870
11 SASI_Hs01_00160072 predicted 490
12 SASI_Hs01_00160074 predicted 1586
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001062303 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00303016 predicted 661
2 SASI_Rn02_00303017 predicted 224
3 SASI_Rn02_00303018 predicted 394
4 SASI_Rn02_00303019 predicted 1014
5 SASI_Rn02_00303020 predicted 316
6 SASI_Rn02_00303021 predicted 281
7 SASI_Rn02_00303022 predicted 381
8 SASI_Rn02_00303023 predicted 993
9 SASI_Rn02_00303024 predicted 1595
10 SASI_Rn02_00303025 predicted 1640
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_577349 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00406527 predicted 262
2 SASI_Rn02_00406528 predicted 436
3 SASI_Rn02_00406529 predicted 633
4 SASI_Rn02_00406530 predicted 2092
5 SASI_Rn02_00406531 predicted 627
6 SASI_Rn02_00406532 predicted 323
7 SASI_Rn02_00406533 predicted 415
8 SASI_Rn02_00406534 predicted 2089
9 SASI_Rn02_00406535 predicted 631
10 SASI_Rn02_00406536 predicted 444
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012363 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00287096 predicted 1491
2 SASI_Mm02_00287097 predicted 1869
3 SASI_Mm02_00287098 predicted 1883
4 SASI_Mm02_00287099 predicted 2029
5 SASI_Mm02_00287100 predicted 1998
6 SASI_Mm02_00287101 predicted 1623
7 SASI_Mm02_00287102 predicted 1745
8 SASI_Mm01_00132262 predicted 327
9 SASI_Mm01_00132263 predicted 302
10 SASI_Mm02_00287103 predicted 1594
11 SASI_Mm01_00132261 predicted 209
12 SASI_Mm01_00132264 predicted 229
13 SASI_Mm01_00132265 predicted 264
14 SASI_Mm01_00132266 predicted 209
15 SASI_Mm01_00132267 predicted 231
16 SASI_Mm01_00132268 predicted 327
17 SASI_Mm01_00132269 predicted 241
18 SASI_Mm01_00132270 predicted 270
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001102414 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00302753 predicted 1689
2 SASI_Mm02_00302754 predicted 2072
3 SASI_Mm02_00302755 predicted 2076
4 SASI_Mm02_00302756 predicted 2228
5 SASI_Mm02_00302757 predicted 2203
6 SASI_Mm02_00302758 predicted 1823
7 SASI_Mm02_00302759 predicted 1951
8 SASI_Mm02_00302760 predicted 528
9 SASI_Mm02_00302761 predicted 498
10 SASI_Mm02_00302762 predicted 1786
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001102415 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00302763 predicted 1375
2 SASI_Mm02_00302764 predicted 1745
3 SASI_Mm02_00302765 predicted 1755
4 SASI_Mm02_00302766 predicted 1914
5 SASI_Mm02_00302767 predicted 1882
6 SASI_Mm02_00302768 predicted 1509
7 SASI_Mm02_00302769 predicted 1632
8 SASI_Mm02_00302770 predicted 526
9 SASI_Mm02_00302771 predicted 498
10 SASI_Mm02_00302772 predicted 1470
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145559 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00341056 predicted 1369
2 SASI_Mm02_00341057 predicted 1741
3 SASI_Mm02_00341058 predicted 1756
4 SASI_Mm02_00341059 predicted 1907
5 SASI_Mm02_00341060 predicted 1868
6 SASI_Mm02_00341061 predicted 1504
7 SASI_Mm02_00341062 predicted 1618
8 SASI_Mm01_00141315 predicted 524
9 SASI_Mm01_00141316 predicted 488
10 SASI_Mm02_00341063 predicted 1465
11 SASI_Mm01_00141314 predicted 420
12 SASI_Mm01_00141317 predicted 444
13 SASI_Mm01_00141318 predicted 488
14 SASI_Mm01_00141319 predicted 423
15 SASI_Mm01_00141320 predicted 452
16 SASI_Mm01_00141321 predicted 545
17 SASI_Mm01_00141322 predicted 455
18 SASI_Mm01_00141323 predicted 481
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001001290
SLC2A9 MISSION shRNA Bacterial Glycerol Stock
solute carrier family 2 (facilitated glucose transporter), member 9
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000413432    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001290.1-488s21c1
Sequence:CCGGACACTTTGCTGGCCAATAATGCTCGAGCATTATTGGCCAGCAAAGTGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412963    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001290.1-1542s21c1
Sequence:CCGGAGGTGCTATCTACCTGTATTTCTCGAGAAATACAGGTAGATAGCACCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001290.1-583s1c1
Sequence:CCGGCGCTTCATCATGGGCATAGATCTCGAGATCTATGCCCATGATGAAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043685    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001290.1-766s1c1
Sequence:CCGGCCATACCTGTTTGGAGTGATTCTCGAGAATCACTCCAAACAGGTATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043687    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001290.1-1661s1c1
Sequence:CCGGCTGTCACTGATGGTAAGATAACTCGAGTTATCTTACCATCAGTGACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043686    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001290.1-1065s1c1
Sequence:CCGGCCTCAATGCAATTTGGTTCTACTCGAGTAGAACCAAATTGCATTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043683    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001001290.1-1711s1c1
Sequence:CCGGACGTTGGACAATTATGTCAAACTCGAGTTTGACATAATTGTCCAACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001001290
SLC2A9 MISSION shRNA shRNA Plasmid DNA
solute carrier family 2 (facilitated glucose transporter), member 9
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000413432    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001290.1-488s21c1
Sequence:CCGGACACTTTGCTGGCCAATAATGCTCGAGCATTATTGGCCAGCAAAGTGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412963    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001290.1-1542s21c1
Sequence:CCGGAGGTGCTATCTACCTGTATTTCTCGAGAAATACAGGTAGATAGCACCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001290.1-583s1c1
Sequence:CCGGCGCTTCATCATGGGCATAGATCTCGAGATCTATGCCCATGATGAAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043685    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001290.1-766s1c1
Sequence:CCGGCCATACCTGTTTGGAGTGATTCTCGAGAATCACTCCAAACAGGTATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043687    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001290.1-1661s1c1
Sequence:CCGGCTGTCACTGATGGTAAGATAACTCGAGTTATCTTACCATCAGTGACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043686    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001290.1-1065s1c1
Sequence:CCGGCCTCAATGCAATTTGGTTCTACTCGAGTAGAACCAAATTGCATTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043683    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001001290.1-1711s1c1
Sequence:CCGGACGTTGGACAATTATGTCAAACTCGAGTTTGACATAATTGTCCAACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001001290
SLC2A9 MISSION shRNA Lentiviral Transduction Particles
solute carrier family 2 (facilitated glucose transporter), member 9
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000413432    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001290.1-488s21c1
Sequence:CCGGACACTTTGCTGGCCAATAATGCTCGAGCATTATTGGCCAGCAAAGTGTTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000412963    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001290.1-1542s21c1
Sequence:CCGGAGGTGCTATCTACCTGTATTTCTCGAGAAATACAGGTAGATAGCACCTTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000043684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001290.1-583s1c1
Sequence:CCGGCGCTTCATCATGGGCATAGATCTCGAGATCTATGCCCATGATGAAGCGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000043685    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001290.1-766s1c1
Sequence:CCGGCCATACCTGTTTGGAGTGATTCTCGAGAATCACTCCAAACAGGTATGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000043687    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001290.1-1661s1c1
Sequence:CCGGCTGTCACTGATGGTAAGATAACTCGAGTTATCTTACCATCAGTGACAGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000043686    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001290.1-1065s1c1
Sequence:CCGGCCTCAATGCAATTTGGTTCTACTCGAGTAGAACCAAATTGCATTGAGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000043683    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001001290.1-1711s1c1
Sequence:CCGGACGTTGGACAATTATGTCAAACTCGAGTTTGACATAATTGTCCAACGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145559
SLC2A9 MISSION shRNA Bacterial Glycerol Stock
solute carrier family 2 (facilitated glucose transporter), member 9
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000079402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145559.1-1245s1c1
Sequence:CCGGGCCACAATATGTATCGCAGGTCTCGAGACCTGCGATACATATTGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000079398    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145559.1-3071s1c1
Sequence:CCGGGCGGGAATAGATGGGATCTTACTCGAGTAAGATCCCATCTATTCCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000079401    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145559.1-725s1c1
Sequence:CCGGGACTGCCATCTTCATCTGCATCTCGAGATGCAGATGAAGATGGCAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000079399    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145559.1-1041s1c1
Sequence:CCGGGTGTGCATCTTGGCCATCATTCTCGAGAATGATGGCCAAGATGCACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000079400    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145559.1-1259s1c1
Sequence:CCGGCGCAGGTGCTACCTACTTCTACTCGAGTAGAAGTAGGTAGCACCTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145559
SLC2A9 MISSION shRNA shRNA Plasmid DNA
solute carrier family 2 (facilitated glucose transporter), member 9
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000079402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145559.1-1245s1c1
Sequence:CCGGGCCACAATATGTATCGCAGGTCTCGAGACCTGCGATACATATTGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000079398    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145559.1-3071s1c1
Sequence:CCGGGCGGGAATAGATGGGATCTTACTCGAGTAAGATCCCATCTATTCCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000079401    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145559.1-725s1c1
Sequence:CCGGGACTGCCATCTTCATCTGCATCTCGAGATGCAGATGAAGATGGCAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000079399    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145559.1-1041s1c1
Sequence:CCGGGTGTGCATCTTGGCCATCATTCTCGAGAATGATGGCCAAGATGCACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000079400    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145559.1-1259s1c1
Sequence:CCGGCGCAGGTGCTACCTACTTCTACTCGAGTAGAAGTAGGTAGCACCTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145559
SLC2A9 MISSION shRNA Lentiviral Transduction Particles
solute carrier family 2 (facilitated glucose transporter), member 9
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000079402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145559.1-1245s1c1
Sequence:CCGGGCCACAATATGTATCGCAGGTCTCGAGACCTGCGATACATATTGTGGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000079398    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145559.1-3071s1c1
Sequence:CCGGGCGGGAATAGATGGGATCTTACTCGAGTAAGATCCCATCTATTCCCGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000079401    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145559.1-725s1c1
Sequence:CCGGGACTGCCATCTTCATCTGCATCTCGAGATGCAGATGAAGATGGCAGTCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000079399    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145559.1-1041s1c1
Sequence:CCGGGTGTGCATCTTGGCCATCATTCTCGAGAATGATGGCCAAGATGCACACTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000079400    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145559.1-1259s1c1
Sequence:CCGGCGCAGGTGCTACCTACTTCTACTCGAGTAGAAGTAGGTAGCACCTGCGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???