EMAIL THIS PAGE TO A FRIEND

SLC30A2

solute carrier family 30 (zinc transporter), member 2

72 Gene Product Result for
Synonyms: PP12488 TNZD ZNT2 ZnT-2
UniProtKB ID: Q9BRI3, Q71RC8
Gene ID:
Mouse(230810) solute carrier family 30 (zinc transporter), member 2
Rat(25362) solute carrier family 30 (zinc transporter), member 2
Zebrafish(563540) solute carrier family 30 (zinc transporter), member 2
Horse(100057323) solute carrier family 30 (zinc transporter), member 2
chicken(425575) solute carrier family 30 (zinc transporter), member 2
dog(478173) solute carrier family 30 (zinc transporter), member 2
domestic cat(101100235) solute carrier family 30 (zinc transporter), member 2
naked mole-rat(101703981) solute carrier family 30 (zinc transporter), member 2
Domestic Rabbit(100338331) solute carrier family 30 (zinc transporter), member 2
domestic guinea pig(100731749) solute carrier family 30 (zinc transporter), member 2
cow(511061) solute carrier family 30 (zinc transporter), member 2
sheep(101117314) solute carrier family 30 (zinc transporter), member 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001039677 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001039677 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001039677 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_032513 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032513 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032513 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU121111 MISSION® esiRNA targeting human SLC30A2 human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001004434 Rosetta Predictions human pricing
NM_032513 Rosetta Predictions human pricing
NM_001083122 Rosetta Predictions rat pricing
NM_012890 Rosetta Predictions rat pricing
NM_001039677 Rosetta Predictions mouse pricing
XM_975361 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004434 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00055662 predicted 1604
2 SASI_Hs01_00055663 predicted 1267
3 SASI_Hs01_00055664 predicted 1006
4 SASI_Hs01_00055665 predicted 1324
5 SASI_Hs01_00055666 predicted 1181
6 SASI_Hs01_00055667 predicted 1566
7 SASI_Hs01_00055668 predicted 1588
8 SASI_Hs01_00055669 predicted 1776
9 SASI_Hs02_00304587 predicted 1678
10 SASI_Hs01_00055670 predicted 873
11 SASI_Hs01_00055671 predicted 880
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032513 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00191346 predicted 1449
2 SASI_Hs01_00191347 predicted 1113
3 SASI_Hs01_00191348 predicted 864
4 SASI_Hs01_00191349 predicted 1173
5 SASI_Hs01_00191350 predicted 1032
6 SASI_Hs01_00191351 predicted 1422
7 SASI_Hs01_00191352 predicted 1443
8 SASI_Hs01_00191353 predicted 1628
9 SASI_Hs02_00360007 predicted 1535
10 SASI_Hs01_00191354 predicted 733
11 SASI_Hs01_00191355 predicted 736
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001083122 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00208839 predicted 1111
2 SASI_Rn02_00208840 predicted 920
3 SASI_Rn02_00208841 predicted 580
4 SASI_Rn02_00208842 predicted 505
5 SASI_Rn02_00208843 predicted 1044
6 SASI_Rn02_00208844 predicted 983
7 SASI_Rn02_00208845 predicted 908
8 SASI_Rn02_00208846 predicted 1119
9 SASI_Rn02_00208847 predicted 643
10 SASI_Rn02_00208848 predicted 1192
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012890 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00046698 predicted 1053
2 SASI_Rn01_00046701 predicted 854
3 SASI_Rn01_00046702 predicted 518
4 SASI_Rn01_00046703 predicted 438
5 SASI_Rn02_00260409 predicted 982
6 SASI_Rn01_00046704 predicted 918
7 SASI_Rn02_00260410 predicted 845
8 SASI_Rn02_00260411 predicted 1059
9 SASI_Rn02_00260412 predicted 584
10 SASI_Rn01_00046705 predicted 1139
11 SASI_Rn01_00046699 predicted 827
12 SASI_Rn01_00046700 predicted 493
13 SASI_Rn01_00046706 predicted 723
14 SASI_Rn01_00046707 predicted 959
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039677 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00083517 predicted 727
2 SASI_Mm01_00083518 predicted 437
3 SASI_Mm01_00083519 predicted 1125
4 SASI_Mm01_00083520 predicted 579
5 SASI_Mm01_00083521 predicted 419
6 SASI_Mm01_00083522 predicted 925
7 SASI_Mm01_00083523 predicted 698
8 SASI_Mm01_00083524 predicted 530
9 SASI_Mm01_00083525 predicted 443
10 SASI_Mm02_00290206 predicted 344
11 SASI_Mm01_00083516 predicted 919
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_975361 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00230102 predicted 939
2 SASI_Mm01_00230103 predicted 754
3 SASI_Mm01_00230104 predicted 466
4 SASI_Mm01_00230105 predicted 1153
5 SASI_Mm01_00230106 predicted 609
6 SASI_Mm01_00230107 predicted 453
7 SASI_Mm01_00230108 predicted 954
8 SASI_Mm01_00230109 predicted 720
9 SASI_Mm01_00230110 predicted 568
10 SASI_Mm01_00230111 predicted 473
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001039677
SLC30A2 MISSION shRNA Bacterial Glycerol Stock
solute carrier family 30 (zinc transporter), member 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000265236    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039677.1-451s21c1
Sequence:CCGGGGTGTTCATGATTGGCGAAATCTCGAGATTTCGCCAATCATGAACACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251766    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039677.1-342s21c1
Sequence:CCGGCTGTCCAGAGCAACCATTATTCTCGAGAATAATGGTTGCTCTGGACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251765    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039677.1-920s21c1
Sequence:CCGGGTGGCAGCCTATATCATATACCTCGAGGTATATGATATAGGCTGCCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251764    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039677.1-760s21c1
Sequence:CCGGTGTGGCTGTGAACCTCATAATCTCGAGATTATGAGGTTCACAGCCACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251767    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039677.1-699s21c1
Sequence:CCGGGGTTGATTTCTGGAGATTATGCTCGAGCATAATCTCCAGAAATCAACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001039677
SLC30A2 MISSION shRNA shRNA Plasmid DNA
solute carrier family 30 (zinc transporter), member 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000265236    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039677.1-451s21c1
Sequence:CCGGGGTGTTCATGATTGGCGAAATCTCGAGATTTCGCCAATCATGAACACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251766    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039677.1-342s21c1
Sequence:CCGGCTGTCCAGAGCAACCATTATTCTCGAGAATAATGGTTGCTCTGGACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251765    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039677.1-920s21c1
Sequence:CCGGGTGGCAGCCTATATCATATACCTCGAGGTATATGATATAGGCTGCCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251764    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039677.1-760s21c1
Sequence:CCGGTGTGGCTGTGAACCTCATAATCTCGAGATTATGAGGTTCACAGCCACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251767    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039677.1-699s21c1
Sequence:CCGGGGTTGATTTCTGGAGATTATGCTCGAGCATAATCTCCAGAAATCAACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001039677
SLC30A2 MISSION shRNA Lentiviral Transduction Particles
solute carrier family 30 (zinc transporter), member 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000265236    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039677.1-451s21c1
Sequence:CCGGGGTGTTCATGATTGGCGAAATCTCGAGATTTCGCCAATCATGAACACCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000251766    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039677.1-342s21c1
Sequence:CCGGCTGTCCAGAGCAACCATTATTCTCGAGAATAATGGTTGCTCTGGACAGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000251765    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039677.1-920s21c1
Sequence:CCGGGTGGCAGCCTATATCATATACCTCGAGGTATATGATATAGGCTGCCACTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000251764    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039677.1-760s21c1
Sequence:CCGGTGTGGCTGTGAACCTCATAATCTCGAGATTATGAGGTTCACAGCCACATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000251767    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039677.1-699s21c1
Sequence:CCGGGGTTGATTTCTGGAGATTATGCTCGAGCATAATCTCCAGAAATCAACCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032513
SLC30A2 MISSION shRNA Bacterial Glycerol Stock
solute carrier family 30 (zinc transporter), member 2
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000038314    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032513.2-736s1c1
Sequence:CCGGCCATGTGATCGGCGACTTTATCTCGAGATAAAGTCGCCGATCACATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038318    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032513.2-1132s1c1
Sequence:CCGGCGAGGACTACTCGGAGGACATCTCGAGATGTCCTCCGAGTAGTCCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032513.2-472s1c1
Sequence:CCGGGATCGGAGAAGTCGTTGAGATCTCGAGATCTCAACGACTTCTCCGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038315    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032513.2-802s1c1
Sequence:CCGGGCCAGAATACAAGTATGTAGACTCGAGTCTACATACTTGTATTCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038316    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032513.2-1032s1c1
Sequence:CCGGACATCGCCATTGCTCAGAATACTCGAGTATTCTGAGCAATGGCGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420571    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032513.3-1635s21c1
Sequence:CCGGAGGACCCTCACACTCTCATTTCTCGAGAAATGAGAGTGTGAGGGTCCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032513
SLC30A2 MISSION shRNA shRNA Plasmid DNA
solute carrier family 30 (zinc transporter), member 2
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000038314    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032513.2-736s1c1
Sequence:CCGGCCATGTGATCGGCGACTTTATCTCGAGATAAAGTCGCCGATCACATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000038318    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032513.2-1132s1c1
Sequence:CCGGCGAGGACTACTCGGAGGACATCTCGAGATGTCCTCCGAGTAGTCCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000038317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032513.2-472s1c1
Sequence:CCGGGATCGGAGAAGTCGTTGAGATCTCGAGATCTCAACGACTTCTCCGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000038315    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032513.2-802s1c1
Sequence:CCGGGCCAGAATACAAGTATGTAGACTCGAGTCTACATACTTGTATTCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000038316    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032513.2-1032s1c1
Sequence:CCGGACATCGCCATTGCTCAGAATACTCGAGTATTCTGAGCAATGGCGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420571    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032513.3-1635s21c1
Sequence:CCGGAGGACCCTCACACTCTCATTTCTCGAGAAATGAGAGTGTGAGGGTCCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032513
SLC30A2 MISSION shRNA Lentiviral Transduction Particles
solute carrier family 30 (zinc transporter), member 2
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000038314    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032513.2-736s1c1
Sequence:CCGGCCATGTGATCGGCGACTTTATCTCGAGATAAAGTCGCCGATCACATGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000038318    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032513.2-1132s1c1
Sequence:CCGGCGAGGACTACTCGGAGGACATCTCGAGATGTCCTCCGAGTAGTCCTCGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000038317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032513.2-472s1c1
Sequence:CCGGGATCGGAGAAGTCGTTGAGATCTCGAGATCTCAACGACTTCTCCGATCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000038315    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032513.2-802s1c1
Sequence:CCGGGCCAGAATACAAGTATGTAGACTCGAGTCTACATACTTGTATTCTGGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000038316    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032513.2-1032s1c1
Sequence:CCGGACATCGCCATTGCTCAGAATACTCGAGTATTCTGAGCAATGGCGATGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000420571    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032513.3-1635s21c1
Sequence:CCGGAGGACCCTCACACTCTCATTTCTCGAGAAATGAGAGTGTGAGGGTCCTTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???