EMAIL THIS PAGE TO A FRIEND

SLC31A2

solute carrier family 31 (copper transporter), member 2

142 Gene Product Result for
Synonyms: COPT2 CTR2 hCTR2
UniProtKB ID: O15432
Gene ID:
Mouse(20530) solute carrier family 31, member 2
Rat(298091) solute carrier family 31 (copper transporter), member 2
Zebrafish(563012) solute carrier family 31 (copper transporters), member 2
chicken(425778) solute carrier family 31 (copper transporters), member 2
dog(612526) solute carrier family 31 (copper transporters), member 2
domestic cat(101081337) solute carrier family 31 (copper transporters), member 2
cow(526609) solute carrier family 31 (copper transporters), member 2
sheep(101109241) solute carrier family 31 (copper transporters), member 2
domestic guinea pig(100731907) solute carrier family 31 (copper transporters), member 2
naked mole-rat(101707947) solute carrier family 31 (copper transporters), member 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA014861 Anti-SLC31A2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001860 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001860 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001860 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025286 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025286 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025286 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001860 Rosetta Predictions human pricing
NM_001033693 Rosetta Predictions rat pricing
NM_025286 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001860 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00332685 predicted 534
2 SASI_Hs02_00332686 predicted 373
3 SASI_Hs02_00332687 predicted 371
4 SASI_Hs01_00222225 predicted 395
5 SASI_Hs02_00332688 predicted 446
6 SASI_Hs02_00332689 predicted 526
7 SASI_Hs01_00222224 predicted 390
8 SASI_Hs01_00222229 predicted 633
9 SASI_Hs01_00222230 predicted 429
10 SASI_Hs01_00222231 predicted 507
11 SASI_Hs01_00222222 predicted 704
12 SASI_Hs01_00222223 predicted 486
13 SASI_Hs01_00222226 predicted 343
14 SASI_Hs01_00222227 predicted 325
15 SASI_Hs01_00222228 predicted 471
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033693 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00053554 predicted 383
2 SASI_Rn01_00053555 predicted 476
3 SASI_Rn01_00053557 predicted 470
4 SASI_Rn01_00053558 predicted 738
5 SASI_Rn01_00053559 predicted 306
6 SASI_Rn01_00053560 predicted 441
7 SASI_Rn01_00053561 predicted 219
8 SASI_Rn01_00053562 predicted 450
9 SASI_Rn01_00053563 predicted 361
10 SASI_Rn02_00203713 predicted 431
11 SASI_Rn01_00053556 predicted 741
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025286 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00129105 predicted 541
2 SASI_Mm01_00129106 predicted 258
3 SASI_Mm01_00129107 predicted 845
4 SASI_Mm01_00129108 predicted 339
5 SASI_Mm01_00129109 predicted 761
6 SASI_Mm01_00129110 predicted 795
7 SASI_Mm01_00129111 predicted 260
8 SASI_Mm01_00129112 predicted 917
9 SASI_Mm01_00129113 predicted 527
10 SASI_Mm01_00129114 predicted 867
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001860
VALIDATED
SLC31A2 MISSION shRNA Bacterial Glycerol Stock
solute carrier family 31 (copper transporter), member 2
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435193    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001860.2-221s21c1
Sequence:CCGGTTCTGGCTGTACTGTATGAAGCTCGAGCTTCATACAGTACAGCCAGAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415365    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001860.2-430s21c1
Sequence:CCGGGTCATCGGCTACTTCATCATGCTCGAGCATGATGAAGTAGCCGATGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414419    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001860.2-370s21c1
Sequence:CCGGACCCACCACAGGTGGTATTTGCTCGAGCAAATACCACCTGTGGTGGGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415970    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001860.2-441s21c1
Sequence:CCGGCTTCATCATGCTGGCCGTAATCTCGAGATTACGGCCAGCATGATGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422855    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001860.2-261s21c1
Sequence:CCGGCAAGCTGCTCAACCAGGTACTCTCGAGAGTACCTGGTTGAGCAGCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427181    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001860.2-529s21c1
Sequence:CCGGCCACTTCTCAGCACAGCTTAGCTCGAGCTAAGCTGTGCTGAGAAGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432260    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001860.2-238s21c1
Sequence:CCGGGAAGGCATCAAGGTTGGCAAACTCGAGTTTGCCAACCTTGATGCCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043365    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001860.1-92s1c1
Sequence:CCGGCAGCGGTGCTTCTGTTTGATTCTCGAGAATCAAACAGAAGCACCGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043363    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001860.1-1343s1c1
Sequence:CCGGCCCTCCTTTATCCTCATCTTTCTCGAGAAAGATGAGGATAAAGGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043366    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001860.1-453s1c1
Sequence:CCGGTGTGGGCTACTACCTAGCTTACTCGAGTAAGCTAGGTAGTAGCCCACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043364    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001860.1-348s1c1
Sequence:CCGGCCAGTCTCTAATCCATGTCATCTCGAGATGACATGGATTAGAGACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001860
VALIDATED
SLC31A2 MISSION shRNA shRNA Plasmid DNA
solute carrier family 31 (copper transporter), member 2
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435193    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001860.2-221s21c1
Sequence:CCGGTTCTGGCTGTACTGTATGAAGCTCGAGCTTCATACAGTACAGCCAGAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415365    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001860.2-430s21c1
Sequence:CCGGGTCATCGGCTACTTCATCATGCTCGAGCATGATGAAGTAGCCGATGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414419    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001860.2-370s21c1
Sequence:CCGGACCCACCACAGGTGGTATTTGCTCGAGCAAATACCACCTGTGGTGGGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415970    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001860.2-441s21c1
Sequence:CCGGCTTCATCATGCTGGCCGTAATCTCGAGATTACGGCCAGCATGATGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422855    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001860.2-261s21c1
Sequence:CCGGCAAGCTGCTCAACCAGGTACTCTCGAGAGTACCTGGTTGAGCAGCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427181    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001860.2-529s21c1
Sequence:CCGGCCACTTCTCAGCACAGCTTAGCTCGAGCTAAGCTGTGCTGAGAAGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000432260    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001860.2-238s21c1
Sequence:CCGGGAAGGCATCAAGGTTGGCAAACTCGAGTTTGCCAACCTTGATGCCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043365    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001860.1-92s1c1
Sequence:CCGGCAGCGGTGCTTCTGTTTGATTCTCGAGAATCAAACAGAAGCACCGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043363    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001860.1-1343s1c1
Sequence:CCGGCCCTCCTTTATCCTCATCTTTCTCGAGAAAGATGAGGATAAAGGAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043366    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001860.1-453s1c1
Sequence:CCGGTGTGGGCTACTACCTAGCTTACTCGAGTAAGCTAGGTAGTAGCCCACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043364    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001860.1-348s1c1
Sequence:CCGGCCAGTCTCTAATCCATGTCATCTCGAGATGACATGGATTAGAGACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001860
VALIDATED
SLC31A2 MISSION shRNA Lentiviral Transduction Particles
solute carrier family 31 (copper transporter), member 2
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435193    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001860.2-221s21c1
Sequence:CCGGTTCTGGCTGTACTGTATGAAGCTCGAGCTTCATACAGTACAGCCAGAATTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000415365    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001860.2-430s21c1
Sequence:CCGGGTCATCGGCTACTTCATCATGCTCGAGCATGATGAAGTAGCCGATGACTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000414419    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001860.2-370s21c1
Sequence:CCGGACCCACCACAGGTGGTATTTGCTCGAGCAAATACCACCTGTGGTGGGTTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000415970    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001860.2-441s21c1
Sequence:CCGGCTTCATCATGCTGGCCGTAATCTCGAGATTACGGCCAGCATGATGAAGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000422855    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001860.2-261s21c1
Sequence:CCGGCAAGCTGCTCAACCAGGTACTCTCGAGAGTACCTGGTTGAGCAGCTTGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000427181    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001860.2-529s21c1
Sequence:CCGGCCACTTCTCAGCACAGCTTAGCTCGAGCTAAGCTGTGCTGAGAAGTGGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000432260    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001860.2-238s21c1
Sequence:CCGGGAAGGCATCAAGGTTGGCAAACTCGAGTTTGCCAACCTTGATGCCTTCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000043365    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001860.1-92s1c1
Sequence:CCGGCAGCGGTGCTTCTGTTTGATTCTCGAGAATCAAACAGAAGCACCGCTGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000043363    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001860.1-1343s1c1
Sequence:CCGGCCCTCCTTTATCCTCATCTTTCTCGAGAAAGATGAGGATAAAGGAGGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000043366    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001860.1-453s1c1
Sequence:CCGGTGTGGGCTACTACCTAGCTTACTCGAGTAAGCTAGGTAGTAGCCCACATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000043364    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001860.1-348s1c1
Sequence:CCGGCCAGTCTCTAATCCATGTCATCTCGAGATGACATGGATTAGAGACTGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025286
VALIDATED
SLC31A2 MISSION shRNA Bacterial Glycerol Stock
solute carrier family 31 (copper transporter), member 2
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000311233    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025286.2-253s21c1
Sequence:CCGGCAAGGTTGGCAAAGCCAAATTCTCGAGAATTTGGCTTTGCCAACCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311235    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025286.2-329s21c1
Sequence:CCGGGGACCAGACCAGGATTCTACACTCGAGTGTAGAATCCTGGTCTGGTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303006    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025286.2-535s21c1
Sequence:CCGGCCCACTTCTCAACATGACTTACTCGAGTAAGTCATGTTGAGAAGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305033    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025286.2-848s21c1
Sequence:CCGGGATCTCTGACTGCAAATTAAACTCGAGTTTAATTTGCAGTCAGAGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311234    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025286.2-223s21c1
Sequence:CCGGCTTGCTCCTGGCAGTACTGTACTCGAGTACAGTACTGCCAGGAGCAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068498    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025286.1-998s1c1
Sequence:CCGGGCCTTGGAACACATGAGGATTCTCGAGAATCCTCATGTGTTCCAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068500    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025286.1-422s1c1
Sequence:CCGGCATGTCATTCAGGTGGTAATTCTCGAGAATTACCACCTGAATGACATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068501    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025286.1-354s1c1
Sequence:CCGGCCAGATCAACTTCAGACAATACTCGAGTATTGTCTGAAGTTGATCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068499    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025286.1-535s1c1
Sequence:CCGGCCCACTTCTCAACATGACTTACTCGAGTAAGTCATGTTGAGAAGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025286
VALIDATED
SLC31A2 MISSION shRNA shRNA Plasmid DNA
solute carrier family 31 (copper transporter), member 2
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000311233    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025286.2-253s21c1
Sequence:CCGGCAAGGTTGGCAAAGCCAAATTCTCGAGAATTTGGCTTTGCCAACCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000311235    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025286.2-329s21c1
Sequence:CCGGGGACCAGACCAGGATTCTACACTCGAGTGTAGAATCCTGGTCTGGTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000303006    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025286.2-535s21c1
Sequence:CCGGCCCACTTCTCAACATGACTTACTCGAGTAAGTCATGTTGAGAAGTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000305033    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025286.2-848s21c1
Sequence:CCGGGATCTCTGACTGCAAATTAAACTCGAGTTTAATTTGCAGTCAGAGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000311234    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025286.2-223s21c1
Sequence:CCGGCTTGCTCCTGGCAGTACTGTACTCGAGTACAGTACTGCCAGGAGCAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068498    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025286.1-998s1c1
Sequence:CCGGGCCTTGGAACACATGAGGATTCTCGAGAATCCTCATGTGTTCCAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068500    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025286.1-422s1c1
Sequence:CCGGCATGTCATTCAGGTGGTAATTCTCGAGAATTACCACCTGAATGACATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068501    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025286.1-354s1c1
Sequence:CCGGCCAGATCAACTTCAGACAATACTCGAGTATTGTCTGAAGTTGATCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068499    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025286.1-535s1c1
Sequence:CCGGCCCACTTCTCAACATGACTTACTCGAGTAAGTCATGTTGAGAAGTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025286
VALIDATED
SLC31A2 MISSION shRNA Lentiviral Transduction Particles
solute carrier family 31 (copper transporter), member 2
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000311233    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025286.2-253s21c1
Sequence:CCGGCAAGGTTGGCAAAGCCAAATTCTCGAGAATTTGGCTTTGCCAACCTTGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000311235    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025286.2-329s21c1
Sequence:CCGGGGACCAGACCAGGATTCTACACTCGAGTGTAGAATCCTGGTCTGGTCCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000303006    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025286.2-535s21c1
Sequence:CCGGCCCACTTCTCAACATGACTTACTCGAGTAAGTCATGTTGAGAAGTGGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000305033    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025286.2-848s21c1
Sequence:CCGGGATCTCTGACTGCAAATTAAACTCGAGTTTAATTTGCAGTCAGAGATCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000311234    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025286.2-223s21c1
Sequence:CCGGCTTGCTCCTGGCAGTACTGTACTCGAGTACAGTACTGCCAGGAGCAAGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000068498    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025286.1-998s1c1
Sequence:CCGGGCCTTGGAACACATGAGGATTCTCGAGAATCCTCATGTGTTCCAAGGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000068500    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025286.1-422s1c1
Sequence:CCGGCATGTCATTCAGGTGGTAATTCTCGAGAATTACCACCTGAATGACATGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000068501    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025286.1-354s1c1
Sequence:CCGGCCAGATCAACTTCAGACAATACTCGAGTATTGTCTGAAGTTGATCTGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000068499    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025286.1-535s1c1
Sequence:CCGGCCCACTTCTCAACATGACTTACTCGAGTAAGTCATGTTGAGAAGTGGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???