EMAIL THIS PAGE TO A FRIEND

SLC35D3

solute carrier family 35, member D3

95 Gene Product Result for
Synonyms: FRCL1 bA55K22.3
UniProtKB ID: Q5M8T2, B4DI58, Q5QNZ6, Q6NX71
Gene ID:
Mouse(76157) solute carrier family 35, member D3
Rat(308717) solute carrier family 35, member D3
naked mole-rat(101709863) solute carrier family 35, member D3
domestic guinea pig(100721979) solute carrier family 35, member D3
cow(539925) solute carrier family 35, member D3
sheep(101121524) solute carrier family 35, member D3
chicken(428614) solute carrier family 35, member D3
dog(484001) solute carrier family 35, member D3
domestic cat(101083177) solute carrier family 35, member D3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0432 AQUA Peptide CGAALAGHQLI[R] human, mouse pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_125515 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_125515 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_125515 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001008783 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001008783 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001008783 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU012631 MISSION® esiRNA esiRNA targeting human SLC35D3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001008783 Rosetta Predictions human pricing
NM_001107522 Rosetta Predictions rat pricing
NM_029529 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008783 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00228805 predicted 1849
2 SASI_Hs02_00305580 predicted 1358
3 SASI_Hs01_00228807 predicted 1427
4 SASI_Hs01_00228808 predicted 1850
5 SASI_Hs01_00228809 predicted 1577
6 SASI_Hs01_00228810 predicted 1846
7 SASI_Hs01_00228811 predicted 1630
8 SASI_Hs01_00228812 predicted 1392
9 SASI_Hs01_00228813 predicted 1743
10 SASI_Hs01_00228814 predicted 875
11 SASI_Hs01_00228806 predicted 1783
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107522 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00229655 predicted 1660
2 SASI_Rn02_00229656 predicted 1327
3 SASI_Rn02_00229657 predicted 1007
4 SASI_Rn02_00229658 predicted 1717
5 SASI_Rn02_00229659 predicted 1148
6 SASI_Rn02_00229660 predicted 749
7 SASI_Rn02_00229661 predicted 1609
8 SASI_Rn02_00229662 predicted 1166
9 SASI_Rn02_00229663 predicted 1915
10 SASI_Rn02_00229664 predicted 1335
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029529 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00180828 predicted 1709
2 SASI_Mm01_00180829 predicted 1528
3 SASI_Mm01_00180830 predicted 1596
4 SASI_Mm01_00180831 predicted 1612
5 SASI_Mm01_00180832 predicted 1198
6 SASI_Mm01_00180833 predicted 1600
7 SASI_Mm01_00180834 predicted 1211
8 SASI_Mm01_00180835 predicted 1229
9 SASI_Mm01_00180836 predicted 733
10 SASI_Mm01_00180837 predicted 1145
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_125515
SLC35D3 MISSION shRNA Bacterial Glycerol Stock
solute carrier family 35, member D3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000069096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_125515.3-1166s1c1
Sequence:CCGGACTGCACTGTACCTACATCAACTCGAGTTGATGTAGGTACAGTGCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_125515.3-1278s1c1
Sequence:CCGGTCTCTATTCATTGCTGGCGTTCTCGAGAACGCCAGCAATGAATAGAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069093    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_125515.3-1363s1c1
Sequence:CCGGGCAACTATGAAGATCTGGAATCTCGAGATTCCAGATCTTCATAGTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_125515.3-1557s1c1
Sequence:CCGGGCTAGGAGTTCAAGAGCAGAACTCGAGTTCTGCTCTTGAACTCCTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_125515.3-740s1c1
Sequence:CCGGGCCCATGTACGTAGTCTTCAACTCGAGTTGAAGACTACGTACATGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_125515
SLC35D3 MISSION shRNA shRNA Plasmid DNA
solute carrier family 35, member D3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000069096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_125515.3-1166s1c1
Sequence:CCGGACTGCACTGTACCTACATCAACTCGAGTTGATGTAGGTACAGTGCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_125515.3-1278s1c1
Sequence:CCGGTCTCTATTCATTGCTGGCGTTCTCGAGAACGCCAGCAATGAATAGAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069093    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_125515.3-1363s1c1
Sequence:CCGGGCAACTATGAAGATCTGGAATCTCGAGATTCCAGATCTTCATAGTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_125515.3-1557s1c1
Sequence:CCGGGCTAGGAGTTCAAGAGCAGAACTCGAGTTCTGCTCTTGAACTCCTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_125515.3-740s1c1
Sequence:CCGGGCCCATGTACGTAGTCTTCAACTCGAGTTGAAGACTACGTACATGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_125515
SLC35D3 MISSION shRNA Lentiviral Transduction Particles
solute carrier family 35, member D3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000069096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_125515.3-1166s1c1
Sequence:CCGGACTGCACTGTACCTACATCAACTCGAGTTGATGTAGGTACAGTGCAGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000069097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_125515.3-1278s1c1
Sequence:CCGGTCTCTATTCATTGCTGGCGTTCTCGAGAACGCCAGCAATGAATAGAGATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000069093    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_125515.3-1363s1c1
Sequence:CCGGGCAACTATGAAGATCTGGAATCTCGAGATTCCAGATCTTCATAGTTGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000069094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_125515.3-1557s1c1
Sequence:CCGGGCTAGGAGTTCAAGAGCAGAACTCGAGTTCTGCTCTTGAACTCCTAGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000069095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_125515.3-740s1c1
Sequence:CCGGGCCCATGTACGTAGTCTTCAACTCGAGTTGAAGACTACGTACATGGGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001008783
SLC35D3 MISSION shRNA Bacterial Glycerol Stock
solute carrier family 35, member D3
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000130413    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008783.1-1077s1c1
Sequence:CCGGGACCAGAAAGCAAAGCAACTACTCGAGTAGTTGCTTTGCTTTCTGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130205    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001008783.1-1433s1c1
Sequence:CCGGCGTACCTATGTGCATACACTTCTCGAGAAGTGTATGCACATAGGTACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129298    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008783.1-1035s1c1
Sequence:CCGGCACCCTGGGCTCTATCATTTACTCGAGTAAATGATAGAGCCCAGGGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129640    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001008783.1-1751s1c1
Sequence:CCGGCCAAAGATGGAGTGTAGAAATCTCGAGATTTCTACACTCCATCTTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000131037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008783.1-1064s1c1
Sequence:CCGGCCAAGTTCATGGAGACCAGAACTCGAGTTCTGGTCTCCATGAACTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128777    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008783.1-1039s1c1
Sequence:CCGGCTGGGCTCTATCATTTACTGTCTCGAGACAGTAAATGATAGAGCCCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128542    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008783.1-1361s1c1
Sequence:CCGGCCAGGTATATGAAGAAGGATTCTCGAGAATCCTTCTTCATATACCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128922    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008783.1-243s1c1
Sequence:CCGGCATCTTGCTCAAGTTCCTCATCTCGAGATGAGGAACTTGAGCAAGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130285    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008783.1-1065s1c1
Sequence:CCGGCAAGTTCATGGAGACCAGAAACTCGAGTTTCTGGTCTCCATGAACTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008783.1-1080s1c1
Sequence:CCGGCAGAAAGCAAAGCAACTACGACTCGAGTCGTAGTTGCTTTGCTTTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129024    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001008783.1-2166s1c1
Sequence:CCGGGCAAATGCAATGGCTGGAATACTCGAGTATTCCAGCCATTGCATTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130130    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008783.1-237s1c1
Sequence:CCGGCCTCAACATCTTGCTCAAGTTCTCGAGAACTTGAGCAAGATGTTGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008783.1-234s1c1
Sequence:CCGGCTCCCTCAACATCTTGCTCAACTCGAGTTGAGCAAGATGTTGAGGGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001008783
SLC35D3 MISSION shRNA shRNA Plasmid DNA
solute carrier family 35, member D3
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000130413    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008783.1-1077s1c1
Sequence:CCGGGACCAGAAAGCAAAGCAACTACTCGAGTAGTTGCTTTGCTTTCTGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130205    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001008783.1-1433s1c1
Sequence:CCGGCGTACCTATGTGCATACACTTCTCGAGAAGTGTATGCACATAGGTACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129298    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008783.1-1035s1c1
Sequence:CCGGCACCCTGGGCTCTATCATTTACTCGAGTAAATGATAGAGCCCAGGGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129640    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001008783.1-1751s1c1
Sequence:CCGGCCAAAGATGGAGTGTAGAAATCTCGAGATTTCTACACTCCATCTTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000131037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008783.1-1064s1c1
Sequence:CCGGCCAAGTTCATGGAGACCAGAACTCGAGTTCTGGTCTCCATGAACTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128777    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008783.1-1039s1c1
Sequence:CCGGCTGGGCTCTATCATTTACTGTCTCGAGACAGTAAATGATAGAGCCCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128542    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008783.1-1361s1c1
Sequence:CCGGCCAGGTATATGAAGAAGGATTCTCGAGAATCCTTCTTCATATACCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128922    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008783.1-243s1c1
Sequence:CCGGCATCTTGCTCAAGTTCCTCATCTCGAGATGAGGAACTTGAGCAAGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130285    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008783.1-1065s1c1
Sequence:CCGGCAAGTTCATGGAGACCAGAAACTCGAGTTTCTGGTCTCCATGAACTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008783.1-1080s1c1
Sequence:CCGGCAGAAAGCAAAGCAACTACGACTCGAGTCGTAGTTGCTTTGCTTTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129024    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001008783.1-2166s1c1
Sequence:CCGGGCAAATGCAATGGCTGGAATACTCGAGTATTCCAGCCATTGCATTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130130    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008783.1-237s1c1
Sequence:CCGGCCTCAACATCTTGCTCAAGTTCTCGAGAACTTGAGCAAGATGTTGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008783.1-234s1c1
Sequence:CCGGCTCCCTCAACATCTTGCTCAACTCGAGTTGAGCAAGATGTTGAGGGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001008783
SLC35D3 MISSION shRNA Lentiviral Transduction Particles
solute carrier family 35, member D3
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000130413    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008783.1-1077s1c1
Sequence:CCGGGACCAGAAAGCAAAGCAACTACTCGAGTAGTTGCTTTGCTTTCTGGTCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000130205    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001008783.1-1433s1c1
Sequence:CCGGCGTACCTATGTGCATACACTTCTCGAGAAGTGTATGCACATAGGTACGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000129298    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008783.1-1035s1c1
Sequence:CCGGCACCCTGGGCTCTATCATTTACTCGAGTAAATGATAGAGCCCAGGGTGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000129640    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001008783.1-1751s1c1
Sequence:CCGGCCAAAGATGGAGTGTAGAAATCTCGAGATTTCTACACTCCATCTTTGGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000131037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008783.1-1064s1c1
Sequence:CCGGCCAAGTTCATGGAGACCAGAACTCGAGTTCTGGTCTCCATGAACTTGGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000128777    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008783.1-1039s1c1
Sequence:CCGGCTGGGCTCTATCATTTACTGTCTCGAGACAGTAAATGATAGAGCCCAGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000128542    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008783.1-1361s1c1
Sequence:CCGGCCAGGTATATGAAGAAGGATTCTCGAGAATCCTTCTTCATATACCTGGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000128922    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008783.1-243s1c1
Sequence:CCGGCATCTTGCTCAAGTTCCTCATCTCGAGATGAGGAACTTGAGCAAGATGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000130285    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008783.1-1065s1c1
Sequence:CCGGCAAGTTCATGGAGACCAGAAACTCGAGTTTCTGGTCTCCATGAACTTGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000130250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008783.1-1080s1c1
Sequence:CCGGCAGAAAGCAAAGCAACTACGACTCGAGTCGTAGTTGCTTTGCTTTCTGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000129024    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001008783.1-2166s1c1
Sequence:CCGGGCAAATGCAATGGCTGGAATACTCGAGTATTCCAGCCATTGCATTTGCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000130130    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008783.1-237s1c1
Sequence:CCGGCCTCAACATCTTGCTCAAGTTCTCGAGAACTTGAGCAAGATGTTGAGGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000130972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008783.1-234s1c1
Sequence:CCGGCTCCCTCAACATCTTGCTCAACTCGAGTTGAGCAAGATGTTGAGGGAGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???