EMAIL THIS PAGE TO A FRIEND

SLC35F3

solute carrier family 35, member F3

110 Gene Product Result for
UniProtKB ID: Q8IY50, Q5TDD6, Q8N9C9
Gene ID:
Mouse(210027) solute carrier family 35, member F3
Rat(679321) solute carrier family 35, member F3
chicken(421518) solute carrier family 35, member F3
Horse(100059412) solute carrier family 35, member F3
domestic cat(101083454) solute carrier family 35, member F3
dog(488963) solute carrier family 35, member F3
domestic guinea pig(100714042) solute carrier family 35, member F3
naked mole-rat(101703053) solute carrier family 35, member F3
Domestic Rabbit(100341547) solute carrier family 35, member F3
cow(538365) solute carrier family 35, member F3
sheep(101115936) solute carrier family 35, member F3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173508 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173508 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173508 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_175434 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175434 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175434 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_173508 Rosetta Predictions human pricing
XM_001055820 Rosetta Predictions rat pricing
NM_175434 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173508 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00133040 predicted 1190
2 SASI_Hs01_00133041 predicted 1640
3 SASI_Hs02_00368279 predicted 1156
4 SASI_Hs01_00133043 predicted 1207
5 SASI_Hs01_00133044 predicted 835
6 SASI_Hs01_00133045 predicted 1215
7 SASI_Hs02_00368280 predicted 1330
8 SASI_Hs01_00133046 predicted 1354
9 SASI_Hs01_00133047 predicted 998
10 SASI_Hs01_00133048 predicted 1376
11 SASI_Hs01_00133042 predicted 1174
12 SASI_Hs01_00133049 predicted 1129
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001055820 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00281135 predicted 1452
2 SASI_Rn02_00281136 predicted 343
3 SASI_Rn02_00281137 predicted 1058
4 SASI_Rn02_00281138 predicted 1390
5 SASI_Rn02_00281139 predicted 356
6 SASI_Rn02_00281140 predicted 831
7 SASI_Rn02_00281141 predicted 895
8 SASI_Rn02_00281142 predicted 941
9 SASI_Rn02_00281143 predicted 700
10 SASI_Rn02_00281144 predicted 1255
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175434 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00103512 predicted 751
2 SASI_Mm01_00103513 predicted 625
3 SASI_Mm01_00103514 predicted 1013
4 SASI_Mm01_00103515 predicted 622
5 SASI_Mm01_00103516 predicted 1010
6 SASI_Mm01_00103517 predicted 691
7 SASI_Mm01_00103518 predicted 1542
8 SASI_Mm01_00103519 predicted 991
9 SASI_Mm01_00103520 predicted 891
10 SASI_Mm01_00103521 predicted 1335
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173508
VALIDATED
SLC35F3 MISSION shRNA Bacterial Glycerol Stock
solute carrier family 35, member F3
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000245407    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_173508.2-749s21c1
Sequence:CCGGTACAGGGAATGCTGTCGATTTCTCGAGAAATCGACAGCATTCCCTGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241559    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173508.2-1723s21c1
Sequence:CCGGCGGTAAGTTCTATGGTATTTACTCGAGTAAATACCATAGAACTTACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241558    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_173508.2-378s21c1
Sequence:CCGGTGCGCATCACTGGCTACTATGCTCGAGCATAGTAGCCAGTGATGCGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241556    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 2 Clone ID:NM_173508.2-1313s21c1
Sequence:CCGGTTTGGAATTGCCGTTACATATCTCGAGATATGTAACGGCAATTCCAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241557    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173508.2-1132s21c1
Sequence:CCGGGTTTGGAGAAGCCGCCTTATTCTCGAGAATAAGGCGGCTTCTCCAAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044837    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_173508.1-711s1c1
Sequence:CCGGCGTCTGCAAGTCCACAGAGAACTCGAGTTCTCTGTGGACTTGCAGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044833    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_173508.1-292s1c1
Sequence:CCGGGCGATTAAGGAGGATCTGAAACTCGAGTTTCAGATCCTCCTTAATCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044836    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173508.1-1197s1c1
Sequence:CCGGCATTCCTATTATCCTCTACTTCTCGAGAAGTAGAGGATAATAGGAATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044835    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173508.1-1337s1c1
Sequence:CCGGCCACTCTGATGTCTCTTGGAACTCGAGTTCCAAGAGACATCAGAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173508
VALIDATED
SLC35F3 MISSION shRNA shRNA Plasmid DNA
solute carrier family 35, member F3
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000245407    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_173508.2-749s21c1
Sequence:CCGGTACAGGGAATGCTGTCGATTTCTCGAGAAATCGACAGCATTCCCTGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241559    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173508.2-1723s21c1
Sequence:CCGGCGGTAAGTTCTATGGTATTTACTCGAGTAAATACCATAGAACTTACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241558    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_173508.2-378s21c1
Sequence:CCGGTGCGCATCACTGGCTACTATGCTCGAGCATAGTAGCCAGTGATGCGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241556    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 2 Clone ID:NM_173508.2-1313s21c1
Sequence:CCGGTTTGGAATTGCCGTTACATATCTCGAGATATGTAACGGCAATTCCAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241557    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173508.2-1132s21c1
Sequence:CCGGGTTTGGAGAAGCCGCCTTATTCTCGAGAATAAGGCGGCTTCTCCAAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044837    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_173508.1-711s1c1
Sequence:CCGGCGTCTGCAAGTCCACAGAGAACTCGAGTTCTCTGTGGACTTGCAGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044833    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_173508.1-292s1c1
Sequence:CCGGGCGATTAAGGAGGATCTGAAACTCGAGTTTCAGATCCTCCTTAATCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044836    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173508.1-1197s1c1
Sequence:CCGGCATTCCTATTATCCTCTACTTCTCGAGAAGTAGAGGATAATAGGAATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044835    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173508.1-1337s1c1
Sequence:CCGGCCACTCTGATGTCTCTTGGAACTCGAGTTCCAAGAGACATCAGAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173508
VALIDATED
SLC35F3 MISSION shRNA Lentiviral Transduction Particles
solute carrier family 35, member F3
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000245407    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_173508.2-749s21c1
Sequence:CCGGTACAGGGAATGCTGTCGATTTCTCGAGAAATCGACAGCATTCCCTGTATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241559    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173508.2-1723s21c1
Sequence:CCGGCGGTAAGTTCTATGGTATTTACTCGAGTAAATACCATAGAACTTACCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241558    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_173508.2-378s21c1
Sequence:CCGGTGCGCATCACTGGCTACTATGCTCGAGCATAGTAGCCAGTGATGCGCATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241556    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 2 Clone ID:NM_173508.2-1313s21c1
Sequence:CCGGTTTGGAATTGCCGTTACATATCTCGAGATATGTAACGGCAATTCCAAATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241557    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173508.2-1132s21c1
Sequence:CCGGGTTTGGAGAAGCCGCCTTATTCTCGAGAATAAGGCGGCTTCTCCAAACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044837    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_173508.1-711s1c1
Sequence:CCGGCGTCTGCAAGTCCACAGAGAACTCGAGTTCTCTGTGGACTTGCAGACGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044833    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_173508.1-292s1c1
Sequence:CCGGGCGATTAAGGAGGATCTGAAACTCGAGTTTCAGATCCTCCTTAATCGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044836    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173508.1-1197s1c1
Sequence:CCGGCATTCCTATTATCCTCTACTTCTCGAGAAGTAGAGGATAATAGGAATGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044835    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173508.1-1337s1c1
Sequence:CCGGCCACTCTGATGTCTCTTGGAACTCGAGTTCCAAGAGACATCAGAGTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175434
SLC35F3 MISSION shRNA Bacterial Glycerol Stock
solute carrier family 35, member F3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000069420    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175434.2-1205s1c1
Sequence:CCGGCCTGTAAATGCAGTGGTCGATCTCGAGATCGACCACTGCATTTACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069418    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175434.2-741s1c1
Sequence:CCGGGCTGCAACAAATCATTTGTTTCTCGAGAAACAAATGATTTGTTGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175434.2-1231s1c1
Sequence:CCGGCACCAGTCAGATAGTCTTCAACTCGAGTTGAAGACTATCTGACTGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175434.2-524s1c1
Sequence:CCGGCCATTGTACTACGCAGGACATCTCGAGATGTCCTGCGTAGTACAATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069419    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175434.2-685s1c1
Sequence:CCGGCCTGTACTTACACGCAATAAACTCGAGTTTATTGCGTGTAAGTACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175434
SLC35F3 MISSION shRNA shRNA Plasmid DNA
solute carrier family 35, member F3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000069420    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175434.2-1205s1c1
Sequence:CCGGCCTGTAAATGCAGTGGTCGATCTCGAGATCGACCACTGCATTTACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069418    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175434.2-741s1c1
Sequence:CCGGGCTGCAACAAATCATTTGTTTCTCGAGAAACAAATGATTTGTTGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175434.2-1231s1c1
Sequence:CCGGCACCAGTCAGATAGTCTTCAACTCGAGTTGAAGACTATCTGACTGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175434.2-524s1c1
Sequence:CCGGCCATTGTACTACGCAGGACATCTCGAGATGTCCTGCGTAGTACAATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069419    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175434.2-685s1c1
Sequence:CCGGCCTGTACTTACACGCAATAAACTCGAGTTTATTGCGTGTAAGTACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175434
SLC35F3 MISSION shRNA Lentiviral Transduction Particles
solute carrier family 35, member F3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000069420    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175434.2-1205s1c1
Sequence:CCGGCCTGTAAATGCAGTGGTCGATCTCGAGATCGACCACTGCATTTACAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069418    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175434.2-741s1c1
Sequence:CCGGGCTGCAACAAATCATTTGTTTCTCGAGAAACAAATGATTTGTTGCAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175434.2-1231s1c1
Sequence:CCGGCACCAGTCAGATAGTCTTCAACTCGAGTTGAAGACTATCTGACTGGTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175434.2-524s1c1
Sequence:CCGGCCATTGTACTACGCAGGACATCTCGAGATGTCCTGCGTAGTACAATGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069419    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175434.2-685s1c1
Sequence:CCGGCCTGTACTTACACGCAATAAACTCGAGTTTATTGCGTGTAAGTACAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)