EMAIL THIS PAGE TO A FRIEND

SLC37A2

solute carrier family 37 (glucose-6-phosphate transporter), member 2

50 Gene Product Result for
Synonyms: pp11662
UniProtKB ID: Q8TED4, A8K2P9, Q6P599, Q7Z7P8, Q8TEM2
Gene ID:
Mouse(56857) solute carrier family 37 (glycerol-3-phosphate transporter), member 2
Rat(500973) solute carrier family 37 (glucose-6-phosphate transporter), member 2
naked mole-rat(101696416) solute carrier family 37 (glycerol-3-phosphate transporter), member 2
domestic guinea pig(100721902) solute carrier family 37 (glycerol-3-phosphate transporter), member 2
cow(506687) solute carrier family 37 (glycerol-3-phosphate transporter), member 2
sheep(101109494) solute carrier family 37 (glycerol-3-phosphate transporter), member 2
Zebrafish(406287) solute carrier family 37 (glycerol-3-phosphate transporter), member 2
domestic cat(101085743) solute carrier family 37 (glycerol-3-phosphate transporter), member 2
dog(489303) solute carrier family 37 (glycerol-3-phosphate transporter), member 2
chicken(419704) solute carrier family 37 (glycerol-3-phosphate transporter), member 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_198277 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_198277 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_198277 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_020258 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_020258 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_020258 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU078751 MISSION® esiRNA esiRNA targeting mouse Slc37a2 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_198277 Rosetta Predictions human pricing
XM_001061125 Rosetta Predictions rat pricing
XM_576383 Rosetta Predictions rat pricing
NM_020258 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198277 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00371830 predicted 1456
2 SASI_Hs01_00220988 predicted 1042
3 SASI_Hs01_00220989 predicted 1403
4 SASI_Hs02_00371831 predicted 1967
5 SASI_Hs01_00220991 predicted 455
6 SASI_Hs01_00220992 predicted 1869
7 SASI_Hs01_00220993 predicted 421
8 SASI_Hs01_00220994 predicted 1524
9 SASI_Hs01_00220995 predicted 998
10 SASI_Hs01_00220996 predicted 572
11 SASI_Hs01_00220990 predicted 1784
12 SASI_Hs01_00220997 predicted 1419
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001061125 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00298849 predicted 954
2 SASI_Rn02_00298850 predicted 499
3 SASI_Rn02_00298851 predicted 691
4 SASI_Rn02_00298852 predicted 861
5 SASI_Rn02_00298853 predicted 1230
6 SASI_Rn02_00298854 predicted 1236
7 SASI_Rn02_00298855 predicted 925
8 SASI_Rn02_00298856 predicted 639
9 SASI_Rn02_00298857 predicted 362
10 SASI_Rn02_00298858 predicted 351
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_576383 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00405191 predicted 620
2 SASI_Rn02_00405192 predicted 355
3 SASI_Rn02_00405193 predicted 231
4 SASI_Rn02_00405194 predicted 567
5 SASI_Rn02_00405195 predicted 640
6 SASI_Rn02_00405196 predicted 217
7 SASI_Rn02_00405197 predicted 361
8 SASI_Rn02_00405198 predicted 510
9 SASI_Rn02_00405199 predicted 270
10 SASI_Rn02_00405200 predicted 518
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020258 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00070929 predicted 622
2 SASI_Mm01_00070930 predicted 684
3 SASI_Mm01_00070931 predicted 1221
4 SASI_Mm01_00070932 predicted 357
5 SASI_Mm01_00070933 predicted 1275
6 SASI_Mm01_00070934 predicted 341
7 SASI_Mm01_00070935 predicted 690
8 SASI_Mm01_00070936 predicted 358
9 SASI_Mm01_00070937 predicted 234
10 SASI_Mm02_00325440 predicted 1007
11 SASI_Mm01_00070928 predicted 615
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198277
SLC37A2 MISSION shRNA Bacterial Glycerol Stock
solute carrier family 37 (glucose-6-phosphate transporter), member 2
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000420726    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198277.2-1216s21c1
Sequence:CCGGTCGCCAATGTGGCTCACTTTACTCGAGTAAAGTGAGCCACATTGGCGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416800    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198277.2-884s21c1
Sequence:CCGGCATCGTGCCTGGCATCATTACCTCGAGGTAATGATGCCAGGCACGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043325    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198277.1-110s1c1
Sequence:CCGGGCTGCTGACCTTCCTAATTTACTCGAGTAAATTAGGAAGGTCAGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198277.1-1519s1c1
Sequence:CCGGGCGGCTCTAGTATGGTCCTAACTCGAGTTAGGACCATACTAGAGCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198277.1-198s1c1
Sequence:CCGGGAGCAGATCAAACCCATCAATCTCGAGATTGATGGGTTTGATCTGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414609    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198277.2-1270s21c1
Sequence:CCGGTCGATGTTGGTGGCATCATAGCTCGAGCTATGATGCCACCAACATCGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043324    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198277.1-1466s1c1
Sequence:CCGGCCGGTTAGTATACAAAGAGATCTCGAGATCTCTTTGTATACTAACCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198277
SLC37A2 MISSION shRNA shRNA Plasmid DNA
solute carrier family 37 (glucose-6-phosphate transporter), member 2
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000420726    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198277.2-1216s21c1
Sequence:CCGGTCGCCAATGTGGCTCACTTTACTCGAGTAAAGTGAGCCACATTGGCGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416800    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198277.2-884s21c1
Sequence:CCGGCATCGTGCCTGGCATCATTACCTCGAGGTAATGATGCCAGGCACGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043325    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198277.1-110s1c1
Sequence:CCGGGCTGCTGACCTTCCTAATTTACTCGAGTAAATTAGGAAGGTCAGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198277.1-1519s1c1
Sequence:CCGGGCGGCTCTAGTATGGTCCTAACTCGAGTTAGGACCATACTAGAGCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198277.1-198s1c1
Sequence:CCGGGAGCAGATCAAACCCATCAATCTCGAGATTGATGGGTTTGATCTGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414609    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198277.2-1270s21c1
Sequence:CCGGTCGATGTTGGTGGCATCATAGCTCGAGCTATGATGCCACCAACATCGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043324    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198277.1-1466s1c1
Sequence:CCGGCCGGTTAGTATACAAAGAGATCTCGAGATCTCTTTGTATACTAACCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198277
SLC37A2 MISSION shRNA Lentiviral Transduction Particles
solute carrier family 37 (glucose-6-phosphate transporter), member 2
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000420726    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198277.2-1216s21c1
Sequence:CCGGTCGCCAATGTGGCTCACTTTACTCGAGTAAAGTGAGCCACATTGGCGATTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000416800    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198277.2-884s21c1
Sequence:CCGGCATCGTGCCTGGCATCATTACCTCGAGGTAATGATGCCAGGCACGATGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000043325    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198277.1-110s1c1
Sequence:CCGGGCTGCTGACCTTCCTAATTTACTCGAGTAAATTAGGAAGGTCAGCAGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000043326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198277.1-1519s1c1
Sequence:CCGGGCGGCTCTAGTATGGTCCTAACTCGAGTTAGGACCATACTAGAGCCGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000043327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198277.1-198s1c1
Sequence:CCGGGAGCAGATCAAACCCATCAATCTCGAGATTGATGGGTTTGATCTGCTCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000414609    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198277.2-1270s21c1
Sequence:CCGGTCGATGTTGGTGGCATCATAGCTCGAGCTATGATGCCACCAACATCGATTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000043324    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198277.1-1466s1c1
Sequence:CCGGCCGGTTAGTATACAAAGAGATCTCGAGATCTCTTTGTATACTAACCGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020258
VALIDATED
SLC37A2 MISSION shRNA Bacterial Glycerol Stock
solute carrier family 37 (glucose-6-phosphate transporter), member 2
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000303217    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020258.4-2912s21c1
Sequence:CCGGGCACCAATACAGATTTCCTTTCTCGAGAAAGGAAATCTGTATTGGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305046    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020258.4-800s21c1
Sequence:CCGGTCCACATGCTCTGGTACTTTGCTCGAGCAAAGTACCAGAGCATGTGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374514    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020258.4-1269s21c1
Sequence:CCGGAGTGATCGAGTTCTCTTTATGCTCGAGCATAAAGAGAACTCGATCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374448    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020258.4-1859s21c1
Sequence:CCGGGCAGAAGCAGTGGGTACAAACCTCGAGGTTTGTACCCACTGCTTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305045    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020258.4-1668s21c1
Sequence:CCGGCTCCACTGTCACGGCCATTATCTCGAGATAATGGCCGTGACAGTGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305047    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020258.4-671s21c1
Sequence:CCGGCTTATGCCATTGGCATGTTTACTCGAGTAAACATGCCAATGGCATAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070101    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020258.2-235s1c1
Sequence:CCGGCCTGTTAATGACACCCACGATCTCGAGATCGTGGGTGTCATTAACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070098    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020258.2-2588s1c1
Sequence:CCGGGCACCAATACAGATTTCCTTTCTCGAGAAAGGAAATCTGTATTGGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020258.2-143s1c1
Sequence:CCGGCCTTCCTCATTTATGCCTGTTCTCGAGAACAGGCATAAATGAGGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070100    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020258.2-1220s1c1
Sequence:CCGGCCAGTTCCATAGTGATGTTAACTCGAGTTAACATCACTATGGAACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020258.2-696s1c1
Sequence:CCGGGCCTGGCATTATCACTGCTATCTCGAGATAGCAGTGATAATGCCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020258
VALIDATED
SLC37A2 MISSION shRNA shRNA Plasmid DNA
solute carrier family 37 (glucose-6-phosphate transporter), member 2
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000303217    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020258.4-2912s21c1
Sequence:CCGGGCACCAATACAGATTTCCTTTCTCGAGAAAGGAAATCTGTATTGGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000305046    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020258.4-800s21c1
Sequence:CCGGTCCACATGCTCTGGTACTTTGCTCGAGCAAAGTACCAGAGCATGTGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000374514    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020258.4-1269s21c1
Sequence:CCGGAGTGATCGAGTTCTCTTTATGCTCGAGCATAAAGAGAACTCGATCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000374448    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020258.4-1859s21c1
Sequence:CCGGGCAGAAGCAGTGGGTACAAACCTCGAGGTTTGTACCCACTGCTTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000305045    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020258.4-1668s21c1
Sequence:CCGGCTCCACTGTCACGGCCATTATCTCGAGATAATGGCCGTGACAGTGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000305047    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020258.4-671s21c1
Sequence:CCGGCTTATGCCATTGGCATGTTTACTCGAGTAAACATGCCAATGGCATAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070101    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020258.2-235s1c1
Sequence:CCGGCCTGTTAATGACACCCACGATCTCGAGATCGTGGGTGTCATTAACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070098    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020258.2-2588s1c1
Sequence:CCGGGCACCAATACAGATTTCCTTTCTCGAGAAAGGAAATCTGTATTGGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020258.2-143s1c1
Sequence:CCGGCCTTCCTCATTTATGCCTGTTCTCGAGAACAGGCATAAATGAGGAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070100    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020258.2-1220s1c1
Sequence:CCGGCCAGTTCCATAGTGATGTTAACTCGAGTTAACATCACTATGGAACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020258.2-696s1c1
Sequence:CCGGGCCTGGCATTATCACTGCTATCTCGAGATAGCAGTGATAATGCCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020258
VALIDATED
SLC37A2 MISSION shRNA Lentiviral Transduction Particles
solute carrier family 37 (glucose-6-phosphate transporter), member 2
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000303217    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020258.4-2912s21c1
Sequence:CCGGGCACCAATACAGATTTCCTTTCTCGAGAAAGGAAATCTGTATTGGTGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000305046    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020258.4-800s21c1
Sequence:CCGGTCCACATGCTCTGGTACTTTGCTCGAGCAAAGTACCAGAGCATGTGGATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000374514    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020258.4-1269s21c1
Sequence:CCGGAGTGATCGAGTTCTCTTTATGCTCGAGCATAAAGAGAACTCGATCACTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000374448    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020258.4-1859s21c1
Sequence:CCGGGCAGAAGCAGTGGGTACAAACCTCGAGGTTTGTACCCACTGCTTCTGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000305045    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020258.4-1668s21c1
Sequence:CCGGCTCCACTGTCACGGCCATTATCTCGAGATAATGGCCGTGACAGTGGAGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000305047    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020258.4-671s21c1
Sequence:CCGGCTTATGCCATTGGCATGTTTACTCGAGTAAACATGCCAATGGCATAAGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000070101    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020258.2-235s1c1
Sequence:CCGGCCTGTTAATGACACCCACGATCTCGAGATCGTGGGTGTCATTAACAGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000070098    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020258.2-2588s1c1
Sequence:CCGGGCACCAATACAGATTTCCTTTCTCGAGAAAGGAAATCTGTATTGGTGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000070102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020258.2-143s1c1
Sequence:CCGGCCTTCCTCATTTATGCCTGTTCTCGAGAACAGGCATAAATGAGGAAGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000070100    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020258.2-1220s1c1
Sequence:CCGGCCAGTTCCATAGTGATGTTAACTCGAGTTAACATCACTATGGAACTGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000070099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020258.2-696s1c1
Sequence:CCGGGCCTGGCATTATCACTGCTATCTCGAGATAGCAGTGATAATGCCAGGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???