EMAIL THIS PAGE TO A FRIEND

SLC38A6

solute carrier family 38, member 6

99 Gene Product Result for
Synonyms: NAT-1
UniProtKB ID: Q8IZM9, C9JWA6, Q86SY5
Gene ID:
Mouse(625098) solute carrier family 38, member 6
Rat(299139) solute carrier family 38, member 6
Zebrafish(336741) solute carrier family 38, member 6
Horse(100060809) solute carrier family 38, member 6
chicken(423519) solute carrier family 38, member 6
dog(612894) solute carrier family 38, member 6
domestic cat(101082161) solute carrier family 38, member 6
naked mole-rat(101717798) solute carrier family 38, member 6
domestic guinea pig(100735941) solute carrier family 38, member 6
cow(520243) solute carrier family 38, member 6
sheep(101105333) solute carrier family 38, member 6
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA018508 Anti-SLC38A6 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153811 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_153811 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_153811 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_153811 Rosetta Predictions human pricing
NM_001013099 Rosetta Predictions rat pricing
XM_916892 Rosetta Predictions mouse pricing
XM_983207 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153811 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00121116 predicted 810
2 SASI_Hs01_00121117 predicted 946
3 SASI_Hs02_00367488 predicted 319
4 SASI_Hs02_00367489 predicted 614
5 SASI_Hs01_00121118 predicted 578
6 SASI_Hs01_00121119 predicted 1228
7 SASI_Hs01_00121121 predicted 902
8 SASI_Hs01_00121122 predicted 1277
9 SASI_Hs01_00121123 predicted 956
10 SASI_Hs01_00121124 predicted 1206
11 SASI_Hs01_00121120 predicted 794
12 SASI_Hs01_00121125 predicted 1250
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013099 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00114838 predicted 1393
2 SASI_Rn01_00114840 predicted 744
3 SASI_Rn02_00200753 predicted 1223
4 SASI_Rn01_00114842 predicted 1047
5 SASI_Rn02_00200754 predicted 979
6 SASI_Rn01_00114843 predicted 1116
7 SASI_Rn01_00114844 predicted 1011
8 SASI_Rn01_00114845 predicted 587
9 SASI_Rn01_00114846 predicted 572
10 SASI_Rn01_00114847 predicted 1023
11 SASI_Rn01_00114839 predicted 1001
12 SASI_Rn01_00114841 predicted 545
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_916892 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00440701 predicted 1474
2 SASI_Mm02_00440702 predicted 1443
3 SASI_Mm02_00440703 predicted 736
4 SASI_Mm02_00440704 predicted 849
5 SASI_Mm02_00440705 predicted 365
6 SASI_Mm02_00440706 predicted 1055
7 SASI_Mm02_00440707 predicted 985
8 SASI_Mm02_00440708 predicted 1044
9 SASI_Mm02_00440709 predicted 552
10 SASI_Mm02_00440710 predicted 714
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_983207 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00448061 predicted 428
2 SASI_Mm02_00448062 predicted 231
3 SASI_Mm01_00244783 predicted 266
4 SASI_Mm01_00244786 predicted 363
5 SASI_Mm02_00448063 predicted 356
6 SASI_Mm01_00244787 predicted 262
7 SASI_Mm02_00448064 predicted 366
8 SASI_Mm01_00244789 predicted 431
9 SASI_Mm01_00244790 predicted 382
10 SASI_Mm02_00448065 predicted 223
11 SASI_Mm01_00244782 predicted 243
12 SASI_Mm01_00244784 predicted 275
13 SASI_Mm01_00244785 predicted 278
14 SASI_Mm01_00244788 predicted 220
15 SASI_Mm01_00244791 predicted 247
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153811
VALIDATED
SLC38A6 MISSION shRNA Bacterial Glycerol Stock
solute carrier family 38, member 6
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000322929    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_153811.1-906s21c1
Sequence:CCGGACCTCAATATTGCCCATATACCTCGAGGTATATGGGCAATATTGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300911    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153811.1-310s21c1
Sequence:CCGGGCTTAGCTTATGTTATGGCTACTCGAGTAGCCATAACATAAGCTAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300978    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_153811.1-691s21c1
Sequence:CCGGGCTACACAAGTAGTTTATCATCTCGAGATGATAAACTACTTGTGTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153811.1-691s1c1
Sequence:CCGGGCTACACAAGTAGTTTATCATCTCGAGATGATAAACTACTTGTGTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322860    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153811.1-613s21c1
Sequence:CCGGATGGACAAACACTACTAATAACTCGAGTTATTAGTAGTGTTTGTCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044803    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153811.1-1120s1c1
Sequence:CCGGGCATACTATTTGCTGTGCTTTCTCGAGAAAGCACAGCAAATAGTATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153811.1-1206s1c1
Sequence:CCGGCCATTCTCATGGATTCGCCATCTCGAGATGGCGAATCCATGAGAATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044804    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153811.1-207s1c1
Sequence:CCGGCCGTTGCTAAGCAACGAACTTCTCGAGAAGTTCGTTGCTTAGCAACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044806    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_153811.1-310s1c1
Sequence:CCGGGCTTAGCTTATGTTATGGCTACTCGAGTAGCCATAACATAAGCTAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322859    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_153811.1-1232s21c1
Sequence:CCGGGATCACTCTAGCACTCAATATCTCGAGATATTGAGTGCTAGAGTGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153811
VALIDATED
SLC38A6 MISSION shRNA shRNA Plasmid DNA
solute carrier family 38, member 6
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000322929    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_153811.1-906s21c1
Sequence:CCGGACCTCAATATTGCCCATATACCTCGAGGTATATGGGCAATATTGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000300911    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153811.1-310s21c1
Sequence:CCGGGCTTAGCTTATGTTATGGCTACTCGAGTAGCCATAACATAAGCTAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000300978    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_153811.1-691s21c1
Sequence:CCGGGCTACACAAGTAGTTTATCATCTCGAGATGATAAACTACTTGTGTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153811.1-691s1c1
Sequence:CCGGGCTACACAAGTAGTTTATCATCTCGAGATGATAAACTACTTGTGTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322860    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153811.1-613s21c1
Sequence:CCGGATGGACAAACACTACTAATAACTCGAGTTATTAGTAGTGTTTGTCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044803    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153811.1-1120s1c1
Sequence:CCGGGCATACTATTTGCTGTGCTTTCTCGAGAAAGCACAGCAAATAGTATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153811.1-1206s1c1
Sequence:CCGGCCATTCTCATGGATTCGCCATCTCGAGATGGCGAATCCATGAGAATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044804    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153811.1-207s1c1
Sequence:CCGGCCGTTGCTAAGCAACGAACTTCTCGAGAAGTTCGTTGCTTAGCAACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044806    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_153811.1-310s1c1
Sequence:CCGGGCTTAGCTTATGTTATGGCTACTCGAGTAGCCATAACATAAGCTAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322859    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_153811.1-1232s21c1
Sequence:CCGGGATCACTCTAGCACTCAATATCTCGAGATATTGAGTGCTAGAGTGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153811
VALIDATED
SLC38A6 MISSION shRNA Lentiviral Transduction Particles
solute carrier family 38, member 6
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000322929    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_153811.1-906s21c1
Sequence:CCGGACCTCAATATTGCCCATATACCTCGAGGTATATGGGCAATATTGAGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000300911    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153811.1-310s21c1
Sequence:CCGGGCTTAGCTTATGTTATGGCTACTCGAGTAGCCATAACATAAGCTAAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000300978    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_153811.1-691s21c1
Sequence:CCGGGCTACACAAGTAGTTTATCATCTCGAGATGATAAACTACTTGTGTAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153811.1-691s1c1
Sequence:CCGGGCTACACAAGTAGTTTATCATCTCGAGATGATAAACTACTTGTGTAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322860    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153811.1-613s21c1
Sequence:CCGGATGGACAAACACTACTAATAACTCGAGTTATTAGTAGTGTTTGTCCATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044803    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153811.1-1120s1c1
Sequence:CCGGGCATACTATTTGCTGTGCTTTCTCGAGAAAGCACAGCAAATAGTATGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153811.1-1206s1c1
Sequence:CCGGCCATTCTCATGGATTCGCCATCTCGAGATGGCGAATCCATGAGAATGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044804    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153811.1-207s1c1
Sequence:CCGGCCGTTGCTAAGCAACGAACTTCTCGAGAAGTTCGTTGCTTAGCAACGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044806    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_153811.1-310s1c1
Sequence:CCGGGCTTAGCTTATGTTATGGCTACTCGAGTAGCCATAACATAAGCTAAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322859    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_153811.1-1232s21c1
Sequence:CCGGGATCACTCTAGCACTCAATATCTCGAGATATTGAGTGCTAGAGTGATCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)