EMAIL THIS PAGE TO A FRIEND

SLC39A11

solute carrier family 39, member 11

76 Gene Product Result for
Synonyms: C17orf26 ZIP11
UniProtKB ID: Q8N1S5, B2R8H7, Q8WZ81
Gene ID:
Mouse(69806) solute carrier family 39 (metal ion transporter), member 11
Rat(287796) solute carrier family 39, member 11
Zebrafish(556031) solute carrier family 39 (metal ion transporter), member 11
chicken(771533) solute carrier family 39 (metal ion transporter), member 11
Horse(100052800) solute carrier family 39 (metal ion transporter), member 11
domestic cat(101090564) solute carrier family 39 (metal ion transporter), member 11
dog(610065) solute carrier family 39 (metal ion transporter), member 11
naked mole-rat(101714940) solute carrier family 39 (metal ion transporter), member 11
domestic guinea pig(100723411) solute carrier family 39 (metal ion transporter), member 11
cow(615681) solute carrier family 39 (metal ion transporter), member 11
sheep(101114288) solute carrier family 39 (metal ion transporter), member 11
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_139177 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_139177 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_139177 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027216 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027216 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027216 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU078721 MISSION® esiRNA esiRNA human SLC39A11 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_139177 Rosetta Predictions human pricing
NM_001013042 Rosetta Predictions rat pricing
NM_027216 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139177 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00122988 predicted 744
2 SASI_Hs01_00122989 predicted 1009
3 SASI_Hs01_00122991 predicted 203
4 SASI_Hs01_00122992 predicted 1057
5 SASI_Hs01_00122993 predicted 1231
6 SASI_Hs01_00122994 predicted 764
7 SASI_Hs01_00122996 predicted 234
8 SASI_Hs01_00122997 predicted 756
9 SASI_Hs02_00364216 predicted 1239
10 SASI_Hs02_00364217 predicted 1017
11 SASI_Hs01_00122990 predicted 500
12 SASI_Hs01_00122995 predicted 754
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013042 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00098363 predicted 730
2 SASI_Rn01_00098364 predicted 514
3 SASI_Rn01_00098366 predicted 969
4 SASI_Rn01_00098367 predicted 786
5 SASI_Rn01_00098368 predicted 751
6 SASI_Rn01_00098369 predicted 257
7 SASI_Rn01_00098370 predicted 538
8 SASI_Rn01_00098371 predicted 760
9 SASI_Rn01_00098372 predicted 529
10 SASI_Rn02_00200637 predicted 777
11 SASI_Rn01_00098365 predicted 684
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027216 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00054726 predicted 1379
2 SASI_Mm01_00054727 predicted 1283
3 SASI_Mm01_00054728 predicted 1204
4 SASI_Mm01_00054729 predicted 506
5 SASI_Mm01_00054730 predicted 712
6 SASI_Mm01_00054731 predicted 764
7 SASI_Mm01_00054732 predicted 762
8 SASI_Mm01_00054733 predicted 1017
9 SASI_Mm01_00054734 predicted 1055
10 SASI_Mm01_00054735 predicted 520
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_139177
VALIDATED
SLC39A11 MISSION shRNA Bacterial Glycerol Stock
solute carrier family 39, member 11
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000429192    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139177.3-525s21c1
Sequence:CCGGGTGAACTTTCCATCCGGATAGCTCGAGCTATCCGGATGGAAAGTTCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038364    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_139177.2-671s1c1
Sequence:CCGGGCCATCACTATACACAACGTTCTCGAGAACGTTGTGTATAGTGATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038365    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_139177.2-442s1c1
Sequence:CCGGCGGCTCTACGTTGATGAAGAACTCGAGTTCTTCATCAACGTAGAGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038366    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139177.2-1057s1c1
Sequence:CCGGCCTGGGATTTGTAGTGATGATCTCGAGATCATCACTACAAATCCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038368    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139177.2-173s1c1
Sequence:CCGGGCTCTCGTGTTCGTATTCTCTCTCGAGAGAGAATACGAACACGAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038367    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_139177.2-1010s1c1
Sequence:CCGGGAAGCCCAGATCAGTGGTAATCTCGAGATTACCACTGATCTGGGCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434903    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_139177.3-1249s21c1
Sequence:CCGGTCCTGATTGACTCTGATTATACTCGAGTATAATCAGAGTCAATCAGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421230    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139177.3-796s21c1
Sequence:CCGGCATTGGAATCGGGATCCAGAACTCGAGTTCTGGATCCCGATTCCAATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421707    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_139177.3-1184s21c1
Sequence:CCGGATGGGACAACAAGCTTCTTTCCTCGAGGAAAGAAGCTTGTTGTCCCATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423243    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139177.3-772s21c1
Sequence:CCGGCTTTGAGAGTGCCAGGAATTTCTCGAGAAATTCCTGGCACTCTCAAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_139177
VALIDATED
SLC39A11 MISSION shRNA shRNA Plasmid DNA
solute carrier family 39, member 11
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000429192    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139177.3-525s21c1
Sequence:CCGGGTGAACTTTCCATCCGGATAGCTCGAGCTATCCGGATGGAAAGTTCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000038364    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_139177.2-671s1c1
Sequence:CCGGGCCATCACTATACACAACGTTCTCGAGAACGTTGTGTATAGTGATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000038365    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_139177.2-442s1c1
Sequence:CCGGCGGCTCTACGTTGATGAAGAACTCGAGTTCTTCATCAACGTAGAGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000038366    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139177.2-1057s1c1
Sequence:CCGGCCTGGGATTTGTAGTGATGATCTCGAGATCATCACTACAAATCCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000038368    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139177.2-173s1c1
Sequence:CCGGGCTCTCGTGTTCGTATTCTCTCTCGAGAGAGAATACGAACACGAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000038367    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_139177.2-1010s1c1
Sequence:CCGGGAAGCCCAGATCAGTGGTAATCTCGAGATTACCACTGATCTGGGCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434903    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_139177.3-1249s21c1
Sequence:CCGGTCCTGATTGACTCTGATTATACTCGAGTATAATCAGAGTCAATCAGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421230    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139177.3-796s21c1
Sequence:CCGGCATTGGAATCGGGATCCAGAACTCGAGTTCTGGATCCCGATTCCAATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421707    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_139177.3-1184s21c1
Sequence:CCGGATGGGACAACAAGCTTCTTTCCTCGAGGAAAGAAGCTTGTTGTCCCATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423243    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139177.3-772s21c1
Sequence:CCGGCTTTGAGAGTGCCAGGAATTTCTCGAGAAATTCCTGGCACTCTCAAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_139177
VALIDATED
SLC39A11 MISSION shRNA Lentiviral Transduction Particles
solute carrier family 39, member 11
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000429192    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139177.3-525s21c1
Sequence:CCGGGTGAACTTTCCATCCGGATAGCTCGAGCTATCCGGATGGAAAGTTCACTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000038364    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_139177.2-671s1c1
Sequence:CCGGGCCATCACTATACACAACGTTCTCGAGAACGTTGTGTATAGTGATGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000038365    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_139177.2-442s1c1
Sequence:CCGGCGGCTCTACGTTGATGAAGAACTCGAGTTCTTCATCAACGTAGAGCCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000038366    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139177.2-1057s1c1
Sequence:CCGGCCTGGGATTTGTAGTGATGATCTCGAGATCATCACTACAAATCCCAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000038368    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139177.2-173s1c1
Sequence:CCGGGCTCTCGTGTTCGTATTCTCTCTCGAGAGAGAATACGAACACGAGAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000038367    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_139177.2-1010s1c1
Sequence:CCGGGAAGCCCAGATCAGTGGTAATCTCGAGATTACCACTGATCTGGGCTTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434903    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_139177.3-1249s21c1
Sequence:CCGGTCCTGATTGACTCTGATTATACTCGAGTATAATCAGAGTCAATCAGGATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421230    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139177.3-796s21c1
Sequence:CCGGCATTGGAATCGGGATCCAGAACTCGAGTTCTGGATCCCGATTCCAATGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421707    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_139177.3-1184s21c1
Sequence:CCGGATGGGACAACAAGCTTCTTTCCTCGAGGAAAGAAGCTTGTTGTCCCATTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423243    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139177.3-772s21c1
Sequence:CCGGCTTTGAGAGTGCCAGGAATTTCTCGAGAAATTCCTGGCACTCTCAAAGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027216
SLC39A11 MISSION shRNA Bacterial Glycerol Stock
solute carrier family 39, member 11
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000079578    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027216.2-1862s1c1
Sequence:CCGGCGCTCTTTGAAGAGCACTGTACTCGAGTACAGTGCTCTTCAAAGAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000079581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027216.2-815s1c1
Sequence:CCGGTCTTGCTGTTGGCGTAGGATTCTCGAGAATCCTACGCCAACAGCAAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000079582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027216.2-644s1c1
Sequence:CCGGGCGTGAGAATGGCGAGGTATACTCGAGTATACCTCGCCATTCTCACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000079580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027216.2-1100s1c1
Sequence:CCGGCGTGGTCATGGATGACATCATCTCGAGATGATGTCATCCATGACCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000079579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027216.2-425s1c1
Sequence:CCGGCCTACCATCTGGAGACTGTAACTCGAGTTACAGTCTCCAGATGGTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027216
SLC39A11 MISSION shRNA shRNA Plasmid DNA
solute carrier family 39, member 11
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000079578    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027216.2-1862s1c1
Sequence:CCGGCGCTCTTTGAAGAGCACTGTACTCGAGTACAGTGCTCTTCAAAGAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000079581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027216.2-815s1c1
Sequence:CCGGTCTTGCTGTTGGCGTAGGATTCTCGAGAATCCTACGCCAACAGCAAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000079582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027216.2-644s1c1
Sequence:CCGGGCGTGAGAATGGCGAGGTATACTCGAGTATACCTCGCCATTCTCACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000079580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027216.2-1100s1c1
Sequence:CCGGCGTGGTCATGGATGACATCATCTCGAGATGATGTCATCCATGACCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000079579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027216.2-425s1c1
Sequence:CCGGCCTACCATCTGGAGACTGTAACTCGAGTTACAGTCTCCAGATGGTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027216
SLC39A11 MISSION shRNA Lentiviral Transduction Particles
solute carrier family 39, member 11
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000079578    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027216.2-1862s1c1
Sequence:CCGGCGCTCTTTGAAGAGCACTGTACTCGAGTACAGTGCTCTTCAAAGAGCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000079581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027216.2-815s1c1
Sequence:CCGGTCTTGCTGTTGGCGTAGGATTCTCGAGAATCCTACGCCAACAGCAAGATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000079582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027216.2-644s1c1
Sequence:CCGGGCGTGAGAATGGCGAGGTATACTCGAGTATACCTCGCCATTCTCACGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000079580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027216.2-1100s1c1
Sequence:CCGGCGTGGTCATGGATGACATCATCTCGAGATGATGTCATCCATGACCACGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000079579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027216.2-425s1c1
Sequence:CCGGCCTACCATCTGGAGACTGTAACTCGAGTTACAGTCTCCAGATGGTAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)