EMAIL THIS PAGE TO A FRIEND

SLC3A2

solute carrier family 3 (amino acid transporter heavy chain), member 2

114 Gene Product Result for
Synonyms: 4F2 4F2HC 4T2HC CD98 CD98HC MDU1 NACAE
UniProtKB ID: P08195, Q13543
Gene ID:
Human(6520) Summary: This gene is a member of the solute carrier family and encodes a cell surface, transmembrane protein. The protein exists as the heavy chain of a heterodimer, covalently bound through di-sulfide bonds to one of several possible light chains. The encoded transporter plays a role in regulation of intracellular calcium levels and transports L-type amino acids. Alternatively spliced transcript variants, encoding different isoforms, have been characterized. [provided by RefSeq, Nov 2010]
Mouse(17254) solute carrier family 3 (activators of dibasic and neutral amino acid transport), member 2
Rat(50567) solute carrier family 3 (amino acid transporter heavy chain), member 2
domestic guinea pig(100731455) solute carrier family 3 (activators of dibasic and neutral amino acid transport), member 2
Domestic Rabbit(100009363) solute carrier family 3 (activators of dibasic and neutral amino acid transport), member 2
naked mole-rat(101701746) solute carrier family 3 (activators of dibasic and neutral amino acid transport), member 2
cow(507107) solute carrier family 3 (activators of dibasic and neutral amino acid transport), member 2
sheep(101116778) solute carrier family 3 (activators of dibasic and neutral amino acid transport), member 2
Horse(100064046) solute carrier family 3 (activators of dibasic and neutral amino acid transport), member 2
domestic cat(101093546) solute carrier family 3 (activators of dibasic and neutral amino acid transport), member 2
dog(483777) solute carrier family 3 (activators of dibasic and neutral amino acid transport), member 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0287 AQUA Peptide IGDLQAFVGPEA[R] rat pricing
AQ0286 AQUA Peptide VAEDEAEAGV[K] rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002394 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002394 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002394 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008577 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008577 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008577 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001012661 Rosetta Predictions human pricing
NM_001012662 Rosetta Predictions human pricing
NM_001012663 Rosetta Predictions human pricing
NM_001012664 Rosetta Predictions human pricing
NM_001013251 Rosetta Predictions human pricing
NM_002394 Rosetta Predictions human pricing
NM_019283 Rosetta Predictions rat pricing
NM_008577 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012661 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00063836 predicted 2132
2 SASI_Hs01_00063838 predicted 982
3 SASI_Hs01_00063839 predicted 1527
4 SASI_Hs01_00063841 predicted 1505
5 SASI_Hs02_00306203 predicted 1639
6 SASI_Hs01_00063842 predicted 1653
7 SASI_Hs01_00063843 predicted 1497
8 SASI_Hs01_00063844 predicted 1528
9 SASI_Hs01_00063845 predicted 1447
10 SASI_Hs02_00306204 predicted 1559
11 SASI_Hs01_00063837 predicted 2153
12 SASI_Hs01_00063840 predicted 1839
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012662 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00098987 predicted 2040
2 SASI_Hs01_00098989 predicted 888
3 SASI_Hs01_00098990 predicted 1438
4 SASI_Hs01_00098992 predicted 1412
5 SASI_Hs02_00306205 predicted 1548
6 SASI_Hs01_00098993 predicted 1564
7 SASI_Hs01_00098994 predicted 1405
8 SASI_Hs01_00098995 predicted 1434
9 SASI_Hs01_00098996 predicted 1362
10 SASI_Hs02_00306206 predicted 1472
11 SASI_Hs01_00098988 predicted 2062
12 SASI_Hs01_00098991 predicted 1753
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012663 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00130321 predicted 1953
2 SASI_Hs01_00130323 predicted 796
3 SASI_Hs01_00130324 predicted 1343
4 SASI_Hs01_00130326 predicted 1321
5 SASI_Hs02_00306207 predicted 1451
6 SASI_Hs01_00130327 predicted 1462
7 SASI_Hs01_00130328 predicted 1310
8 SASI_Hs01_00130329 predicted 1342
9 SASI_Hs01_00130330 predicted 1264
10 SASI_Hs02_00306208 predicted 1376
11 SASI_Hs01_00130322 predicted 1971
12 SASI_Hs01_00130325 predicted 1649
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012664 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00087170 predicted 1857
2 SASI_Hs01_00087172 predicted 703
3 SASI_Hs01_00087173 predicted 1242
4 SASI_Hs01_00087175 predicted 1224
5 SASI_Hs02_00306209 predicted 1359
6 SASI_Hs01_00087176 predicted 1373
7 SASI_Hs01_00087177 predicted 1217
8 SASI_Hs01_00087178 predicted 1240
9 SASI_Hs01_00087179 predicted 1172
10 SASI_Hs02_00306210 predicted 1287
11 SASI_Hs01_00087171 predicted 1871
12 SASI_Hs01_00087174 predicted 1556
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013251 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00120836 predicted 1723
2 SASI_Hs01_00120838 predicted 570
3 SASI_Hs01_00120839 predicted 1112
4 SASI_Hs01_00120841 predicted 1095
5 SASI_Hs02_00306329 predicted 1225
6 SASI_Hs01_00120842 predicted 1237
7 SASI_Hs01_00120843 predicted 1085
8 SASI_Hs01_00120844 predicted 1110
9 SASI_Hs01_00120845 predicted 1035
10 SASI_Hs02_00306330 predicted 1150
11 SASI_Hs01_00120837 predicted 1739
12 SASI_Hs01_00120840 predicted 1424
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002394 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00062055 predicted 2046
2 SASI_Hs01_00062057 predicted 887
3 SASI_Hs01_00062058 predicted 1433
4 SASI_Hs01_00062060 predicted 1405
5 SASI_Hs02_00333754 predicted 1543
6 SASI_Hs01_00062061 predicted 1559
7 SASI_Hs01_00062062 predicted 1397
8 SASI_Hs01_00062063 predicted 1434
9 SASI_Hs01_00062064 predicted 1351
10 SASI_Hs02_00333755 predicted 1466
11 SASI_Hs01_00062056 predicted 2057
12 SASI_Hs01_00062059 predicted 1749
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019283 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00083198 predicted 700
2 SASI_Rn01_00083200 predicted 1030
3 SASI_Rn02_00262212 predicted 1633
4 SASI_Rn01_00083201 predicted 1205
5 SASI_Rn01_00083202 predicted 1558
6 SASI_Rn02_00262213 predicted 294
7 SASI_Rn01_00083204 predicted 1123
8 SASI_Rn01_00083205 predicted 969
9 SASI_Rn01_00083206 predicted 1392
10 SASI_Rn02_00262214 predicted 340
11 SASI_Rn01_00083197 predicted 1125
12 SASI_Rn01_00083199 predicted 718
13 SASI_Rn01_00083203 predicted 1470
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008577 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00112234 predicted 580
2 SASI_Mm01_00112235 predicted 1324
3 SASI_Mm02_00314198 predicted 1306
4 SASI_Mm01_00112236 predicted 526
5 SASI_Mm01_00112237 predicted 220
6 SASI_Mm01_00112238 predicted 1715
7 SASI_Mm01_00112239 predicted 1014
8 SASI_Mm01_00112240 predicted 796
9 SASI_Mm01_00112241 predicted 1658
10 SASI_Mm01_00112242 predicted 1481
11 SASI_Mm01_00112243 predicted 1273
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002394
VALIDATED
SLC3A2 MISSION shRNA Bacterial Glycerol Stock
solute carrier family 3 (amino acid transporter heavy chain), member 2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435809    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002394.4-1098s21c1
Sequence:CCGGAGTCTCTTGCAATCGGCTAAACTCGAGTTTAGCCGATTGCAAGAGACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431983    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002394.4-1393s21c1
Sequence:CCGGGCCTACTCGAATCCAACAAAGCTCGAGCTTTGTTGGATTCGAGTAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430528    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002394.4-814s21c1
Sequence:CCGGTTGCTGGTGCCGTGGTCATAACTCGAGTTATGACCACGGCACCAGCAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043383    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_002394.3-1809s1c1
Sequence:CCGGGCCTGGACTCTTCTCCTATATCTCGAGATATAGGAGAAGAGTCCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043385    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002394.3-1073s1c1
Sequence:CCGGTCCGTGTCATTCTGGACCTTACTCGAGTAAGGTCCAGAATGACACGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043384    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_002394.3-582s1c1
Sequence:CCGGCGAGAAGAATGGTCTGGTGAACTCGAGTTCACCAGACCATTCTTCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043386    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_002394.3-948s1c1
Sequence:CCGGGCTGGGTCCAATTCACAAGAACTCGAGTTCTTGTGAATTGGACCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043387    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_002394.3-1370s1c1
Sequence:CCGGCTAGCTCATACCTGTCTGATTCTCGAGAATCAGACAGGTATGAGCTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002394
VALIDATED
SLC3A2 MISSION shRNA shRNA Plasmid DNA
solute carrier family 3 (amino acid transporter heavy chain), member 2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435809    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002394.4-1098s21c1
Sequence:CCGGAGTCTCTTGCAATCGGCTAAACTCGAGTTTAGCCGATTGCAAGAGACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431983    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002394.4-1393s21c1
Sequence:CCGGGCCTACTCGAATCCAACAAAGCTCGAGCTTTGTTGGATTCGAGTAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430528    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002394.4-814s21c1
Sequence:CCGGTTGCTGGTGCCGTGGTCATAACTCGAGTTATGACCACGGCACCAGCAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043383    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_002394.3-1809s1c1
Sequence:CCGGGCCTGGACTCTTCTCCTATATCTCGAGATATAGGAGAAGAGTCCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043385    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002394.3-1073s1c1
Sequence:CCGGTCCGTGTCATTCTGGACCTTACTCGAGTAAGGTCCAGAATGACACGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043384    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_002394.3-582s1c1
Sequence:CCGGCGAGAAGAATGGTCTGGTGAACTCGAGTTCACCAGACCATTCTTCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043386    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_002394.3-948s1c1
Sequence:CCGGGCTGGGTCCAATTCACAAGAACTCGAGTTCTTGTGAATTGGACCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043387    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_002394.3-1370s1c1
Sequence:CCGGCTAGCTCATACCTGTCTGATTCTCGAGAATCAGACAGGTATGAGCTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002394
VALIDATED
SLC3A2 MISSION shRNA Lentiviral Transduction Particles
solute carrier family 3 (amino acid transporter heavy chain), member 2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435809    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002394.4-1098s21c1
Sequence:CCGGAGTCTCTTGCAATCGGCTAAACTCGAGTTTAGCCGATTGCAAGAGACTTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000431983    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002394.4-1393s21c1
Sequence:CCGGGCCTACTCGAATCCAACAAAGCTCGAGCTTTGTTGGATTCGAGTAGGCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000430528    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002394.4-814s21c1
Sequence:CCGGTTGCTGGTGCCGTGGTCATAACTCGAGTTATGACCACGGCACCAGCAATTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000043383    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_002394.3-1809s1c1
Sequence:CCGGGCCTGGACTCTTCTCCTATATCTCGAGATATAGGAGAAGAGTCCAGGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000043385    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002394.3-1073s1c1
Sequence:CCGGTCCGTGTCATTCTGGACCTTACTCGAGTAAGGTCCAGAATGACACGGATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000043384    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_002394.3-582s1c1
Sequence:CCGGCGAGAAGAATGGTCTGGTGAACTCGAGTTCACCAGACCATTCTTCTCGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000043386    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_002394.3-948s1c1
Sequence:CCGGGCTGGGTCCAATTCACAAGAACTCGAGTTCTTGTGAATTGGACCCAGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000043387    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_002394.3-1370s1c1
Sequence:CCGGCTAGCTCATACCTGTCTGATTCTCGAGAATCAGACAGGTATGAGCTAGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008577
VALIDATED
SLC3A2 MISSION shRNA Bacterial Glycerol Stock
solute carrier family 3 (amino acid transporter heavy chain), member 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000313774    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008577.3-629s21c1
Sequence:CCGGACCGACCTGAAACAGATTAATCTCGAGATTAATCTGTTTCAGGTCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317423    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008577.3-1448s21c1
Sequence:CCGGCCTGACCTCTTCTCCTACATACTCGAGTATGTAGGAGAAGAGGTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313842    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008577.3-1955s21c1
Sequence:CCGGGCCAGTTGTAGACAGCTATTCCTCGAGGAATAGCTGTCTACAACTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313843    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008577.3-1124s21c1
Sequence:CCGGGGACTCCTCGCAGACTTTATACTCGAGTATAAAGTCTGCGAGGAGTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313772    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008577.3-963s21c1
Sequence:CCGGTGCAGCAAATTGTCAACATACCTCGAGGTATGTTGACAATTTGCTGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068989    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_008577.2-1449s1c1
Sequence:CCGGCCTGACCTCTTCTCCTACATACTCGAGTATGTAGGAGAAGAGGTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008577.2-1134s1c1
Sequence:CCGGGCAGACTTTATACCGGACCATCTCGAGATGGTCCGGTATAAAGTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008577.2-899s1c1
Sequence:CCGGGCAGAATATCACCAAGAACTTCTCGAGAAGTTCTTGGTGATATTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008577.2-1018s1c1
Sequence:CCGGCCTACCTGTCAAATTCCACTTCTCGAGAAGTGGAATTTGACAGGTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008577.2-683s1c1
Sequence:CCGGCCTTCTACAAAGTGCCAAGAACTCGAGTTCTTGGCACTTTGTAGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008577
VALIDATED
SLC3A2 MISSION shRNA shRNA Plasmid DNA
solute carrier family 3 (amino acid transporter heavy chain), member 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000313774    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008577.3-629s21c1
Sequence:CCGGACCGACCTGAAACAGATTAATCTCGAGATTAATCTGTTTCAGGTCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000317423    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008577.3-1448s21c1
Sequence:CCGGCCTGACCTCTTCTCCTACATACTCGAGTATGTAGGAGAAGAGGTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313842    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008577.3-1955s21c1
Sequence:CCGGGCCAGTTGTAGACAGCTATTCCTCGAGGAATAGCTGTCTACAACTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313843    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008577.3-1124s21c1
Sequence:CCGGGGACTCCTCGCAGACTTTATACTCGAGTATAAAGTCTGCGAGGAGTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313772    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008577.3-963s21c1
Sequence:CCGGTGCAGCAAATTGTCAACATACCTCGAGGTATGTTGACAATTTGCTGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068989    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_008577.2-1449s1c1
Sequence:CCGGCCTGACCTCTTCTCCTACATACTCGAGTATGTAGGAGAAGAGGTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008577.2-1134s1c1
Sequence:CCGGGCAGACTTTATACCGGACCATCTCGAGATGGTCCGGTATAAAGTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008577.2-899s1c1
Sequence:CCGGGCAGAATATCACCAAGAACTTCTCGAGAAGTTCTTGGTGATATTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008577.2-1018s1c1
Sequence:CCGGCCTACCTGTCAAATTCCACTTCTCGAGAAGTGGAATTTGACAGGTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008577.2-683s1c1
Sequence:CCGGCCTTCTACAAAGTGCCAAGAACTCGAGTTCTTGGCACTTTGTAGAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008577
VALIDATED
SLC3A2 MISSION shRNA Lentiviral Transduction Particles
solute carrier family 3 (amino acid transporter heavy chain), member 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000313774    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008577.3-629s21c1
Sequence:CCGGACCGACCTGAAACAGATTAATCTCGAGATTAATCTGTTTCAGGTCGGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000317423    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008577.3-1448s21c1
Sequence:CCGGCCTGACCTCTTCTCCTACATACTCGAGTATGTAGGAGAAGAGGTCAGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000313842    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008577.3-1955s21c1
Sequence:CCGGGCCAGTTGTAGACAGCTATTCCTCGAGGAATAGCTGTCTACAACTGGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000313843    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008577.3-1124s21c1
Sequence:CCGGGGACTCCTCGCAGACTTTATACTCGAGTATAAAGTCTGCGAGGAGTCCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000313772    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008577.3-963s21c1
Sequence:CCGGTGCAGCAAATTGTCAACATACCTCGAGGTATGTTGACAATTTGCTGCATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000068989    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_008577.2-1449s1c1
Sequence:CCGGCCTGACCTCTTCTCCTACATACTCGAGTATGTAGGAGAAGAGGTCAGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000068990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008577.2-1134s1c1
Sequence:CCGGGCAGACTTTATACCGGACCATCTCGAGATGGTCCGGTATAAAGTCTGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000068988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008577.2-899s1c1
Sequence:CCGGGCAGAATATCACCAAGAACTTCTCGAGAAGTTCTTGGTGATATTCTGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000068991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008577.2-1018s1c1
Sequence:CCGGCCTACCTGTCAAATTCCACTTCTCGAGAAGTGGAATTTGACAGGTAGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000068992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008577.2-683s1c1
Sequence:CCGGCCTTCTACAAAGTGCCAAGAACTCGAGTTCTTGGCACTTTGTAGAAGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???