EMAIL THIS PAGE TO A FRIEND

SLC41A2

solute carrier family 41 (magnesium transporter), member 2

59 Gene Product Result for
Synonyms: SLC41A1-L1
UniProtKB ID: Q96JW4, Q3KP68, Q9H0E5
Gene ID:
Mouse(338365) solute carrier family 41, member 2
Rat(362861) solute carrier family 41 (magnesium transporter), member 2
chicken(427913) solute carrier family 41, member 2
dog(481298) solute carrier family 41, member 2
domestic cat(101085988) solute carrier family 41, member 2
Horse(100053603) solute carrier family 41, member 2
cow(524417) solute carrier family 41, member 2
sheep(101113925) solute carrier family 41, member 2
naked mole-rat(101698448) solute carrier family 41, member 2
domestic guinea pig(100719274) solute carrier family 41, member 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_177388 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177388 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177388 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_032148 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032148 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032148 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032148 Rosetta Predictions human pricing
NM_001108742 Rosetta Predictions rat pricing
NM_177388 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032148 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00199514 predicted 1722
2 SASI_Hs02_00359384 predicted 1483
3 SASI_Hs01_00199516 predicted 1560
4 SASI_Hs01_00199518 predicted 1034
5 SASI_Hs01_00199519 predicted 1349
6 SASI_Hs01_00199520 predicted 1623
7 SASI_Hs01_00199521 predicted 786
8 SASI_Hs01_00199522 predicted 1368
9 SASI_Hs01_00199523 predicted 807
10 SASI_Hs02_00359385 predicted 1128
11 SASI_Hs01_00199515 predicted 1123
12 SASI_Hs01_00199517 predicted 467
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108742 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00241635 predicted 633
2 SASI_Rn02_00241636 predicted 996
3 SASI_Rn02_00241637 predicted 1825
4 SASI_Rn02_00241638 predicted 1617
5 SASI_Rn02_00241639 predicted 915
6 SASI_Rn02_00241640 predicted 797
7 SASI_Rn02_00241641 predicted 1443
8 SASI_Rn02_00241642 predicted 1292
9 SASI_Rn02_00241643 predicted 1451
10 SASI_Rn02_00241644 predicted 1270
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177388 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00110907 predicted 571
2 SASI_Mm01_00110908 predicted 1631
3 SASI_Mm01_00110909 predicted 919
4 SASI_Mm01_00110910 predicted 1420
5 SASI_Mm02_00347568 predicted 1447
6 SASI_Mm01_00110911 predicted 615
7 SASI_Mm01_00110912 predicted 1529
8 SASI_Mm01_00110913 predicted 1228
9 SASI_Mm01_00110914 predicted 1463
10 SASI_Mm01_00110915 predicted 1206
11 SASI_Mm01_00110916 predicted 952
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177388
SLC41A2 MISSION shRNA Bacterial Glycerol Stock
solute carrier family 41 (magnesium transporter), member 2
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000175192    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177388.2-2435s1c1
Sequence:CCGGCCAGTTACTTAACTCACAATACTCGAGTATTGTGAGTTAAGTAACTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175114    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177388.2-3237s1c1
Sequence:CCGGGCTGTGGTTTAGAGTTGTATACTCGAGTATACAACTCTAAACCACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174039    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177388.2-877s1c1
Sequence:CCGGCGCTGGCTTCTCGATTATCTACTCGAGTAGATAATCGAGAAGCCAGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353343    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177388.3-1045s21c1
Sequence:CCGGGTATTACCTCAGCCATTCCATCTCGAGATGGAATGGCTGAGGTAATACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328132    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177388.3-1211s21c1
Sequence:CCGGCTGATAACTCTCGCCATATTACTCGAGTAATATGGCGAGAGTTATCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177388.2-1221s1c1
Sequence:CCGGCTCGCCATATTAGCTTGGATACTCGAGTATCCAAGCTAATATGGCGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177388.3-1255s1c1
Sequence:CCGGCTCCTGTCTTGAGACATATTACTCGAGTAATATGTCTCAAGACAGGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353344    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177388.3-2072s21c1
Sequence:CCGGGTTCACCCTGACTCCGTAAATCTCGAGATTTACGGAGTCAGGGTGAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328194    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177388.3-840s21c1
Sequence:CCGGCCGCGCTTCTTGGTCTTAAAGCTCGAGCTTTAAGACCAAGAAGCGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175769    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177388.2-1046s1c1
Sequence:CCGGGTATTACCTCAGCCATTCCATCTCGAGATGGAATGGCTGAGGTAATACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177388.2-1541s1c1
Sequence:CCGGCTACCTCCATTTACATAGCATCTCGAGATGCTATGTAAATGGAGGTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328131    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177388.3-876s21c1
Sequence:CCGGCGCTGGCTTCTCGATTATCTACTCGAGTAGATAATCGAGAAGCCAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177388
SLC41A2 MISSION shRNA shRNA Plasmid DNA
solute carrier family 41 (magnesium transporter), member 2
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000175192    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177388.2-2435s1c1
Sequence:CCGGCCAGTTACTTAACTCACAATACTCGAGTATTGTGAGTTAAGTAACTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175114    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177388.2-3237s1c1
Sequence:CCGGGCTGTGGTTTAGAGTTGTATACTCGAGTATACAACTCTAAACCACAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174039    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177388.2-877s1c1
Sequence:CCGGCGCTGGCTTCTCGATTATCTACTCGAGTAGATAATCGAGAAGCCAGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000353343    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177388.3-1045s21c1
Sequence:CCGGGTATTACCTCAGCCATTCCATCTCGAGATGGAATGGCTGAGGTAATACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000328132    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177388.3-1211s21c1
Sequence:CCGGCTGATAACTCTCGCCATATTACTCGAGTAATATGGCGAGAGTTATCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177388.2-1221s1c1
Sequence:CCGGCTCGCCATATTAGCTTGGATACTCGAGTATCCAAGCTAATATGGCGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177388.3-1255s1c1
Sequence:CCGGCTCCTGTCTTGAGACATATTACTCGAGTAATATGTCTCAAGACAGGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000353344    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177388.3-2072s21c1
Sequence:CCGGGTTCACCCTGACTCCGTAAATCTCGAGATTTACGGAGTCAGGGTGAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000328194    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177388.3-840s21c1
Sequence:CCGGCCGCGCTTCTTGGTCTTAAAGCTCGAGCTTTAAGACCAAGAAGCGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175769    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177388.2-1046s1c1
Sequence:CCGGGTATTACCTCAGCCATTCCATCTCGAGATGGAATGGCTGAGGTAATACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177388.2-1541s1c1
Sequence:CCGGCTACCTCCATTTACATAGCATCTCGAGATGCTATGTAAATGGAGGTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000328131    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177388.3-876s21c1
Sequence:CCGGCGCTGGCTTCTCGATTATCTACTCGAGTAGATAATCGAGAAGCCAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177388
SLC41A2 MISSION shRNA Lentiviral Transduction Particles
solute carrier family 41 (magnesium transporter), member 2
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000175192    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177388.2-2435s1c1
Sequence:CCGGCCAGTTACTTAACTCACAATACTCGAGTATTGTGAGTTAAGTAACTGGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000175114    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177388.2-3237s1c1
Sequence:CCGGGCTGTGGTTTAGAGTTGTATACTCGAGTATACAACTCTAAACCACAGCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000174039    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177388.2-877s1c1
Sequence:CCGGCGCTGGCTTCTCGATTATCTACTCGAGTAGATAATCGAGAAGCCAGCGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000353343    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177388.3-1045s21c1
Sequence:CCGGGTATTACCTCAGCCATTCCATCTCGAGATGGAATGGCTGAGGTAATACTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000328132    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177388.3-1211s21c1
Sequence:CCGGCTGATAACTCTCGCCATATTACTCGAGTAATATGGCGAGAGTTATCAGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000193890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177388.2-1221s1c1
Sequence:CCGGCTCGCCATATTAGCTTGGATACTCGAGTATCCAAGCTAATATGGCGAGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000217762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177388.3-1255s1c1
Sequence:CCGGCTCCTGTCTTGAGACATATTACTCGAGTAATATGTCTCAAGACAGGAGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000353344    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177388.3-2072s21c1
Sequence:CCGGGTTCACCCTGACTCCGTAAATCTCGAGATTTACGGAGTCAGGGTGAACTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000328194    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177388.3-840s21c1
Sequence:CCGGCCGCGCTTCTTGGTCTTAAAGCTCGAGCTTTAAGACCAAGAAGCGCGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000175769    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177388.2-1046s1c1
Sequence:CCGGGTATTACCTCAGCCATTCCATCTCGAGATGGAATGGCTGAGGTAATACTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000174386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177388.2-1541s1c1
Sequence:CCGGCTACCTCCATTTACATAGCATCTCGAGATGCTATGTAAATGGAGGTAGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000328131    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177388.3-876s21c1
Sequence:CCGGCGCTGGCTTCTCGATTATCTACTCGAGTAGATAATCGAGAAGCCAGCGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032148
SLC41A2 MISSION shRNA Bacterial Glycerol Stock
solute carrier family 41 (magnesium transporter), member 2
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000043949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032148.2-740s1c1
Sequence:CCGGCCTGCACTTCTTGGTCTCAAACTCGAGTTTGAGACCAAGAAGTGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043948    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032148.2-1662s1c1
Sequence:CCGGGCGCTGTGTTACAGGTATTTACTCGAGTAAATACCTGTAACACAGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043950    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032148.2-1463s1c1
Sequence:CCGGCCAGGAGAATTGCCTGATGAACTCGAGTTCATCAGGCAATTCTCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422258    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032148.3-239s21c1
Sequence:CCGGAGATTGGACTTTACGTTTAAACTCGAGTTTAAACGTAAAGTCCAATCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032148.2-521s1c1
Sequence:CCGGGCCATGTTACAAGATGAAGATCTCGAGATCTTCATCTTGTAACATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420325    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032148.3-1418s21c1
Sequence:CCGGTAATGGTATTGGTGGTAATTTCTCGAGAAATTACCACCAATACCATTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420283    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032148.3-356s21c1
Sequence:CCGGCATTTGGCAAGATGGATTATCCTCGAGGATAATCCATCTTGCCAAATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032148
SLC41A2 MISSION shRNA shRNA Plasmid DNA
solute carrier family 41 (magnesium transporter), member 2
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000043949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032148.2-740s1c1
Sequence:CCGGCCTGCACTTCTTGGTCTCAAACTCGAGTTTGAGACCAAGAAGTGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043948    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032148.2-1662s1c1
Sequence:CCGGGCGCTGTGTTACAGGTATTTACTCGAGTAAATACCTGTAACACAGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043950    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032148.2-1463s1c1
Sequence:CCGGCCAGGAGAATTGCCTGATGAACTCGAGTTCATCAGGCAATTCTCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422258    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032148.3-239s21c1
Sequence:CCGGAGATTGGACTTTACGTTTAAACTCGAGTTTAAACGTAAAGTCCAATCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032148.2-521s1c1
Sequence:CCGGGCCATGTTACAAGATGAAGATCTCGAGATCTTCATCTTGTAACATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420325    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032148.3-1418s21c1
Sequence:CCGGTAATGGTATTGGTGGTAATTTCTCGAGAAATTACCACCAATACCATTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420283    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032148.3-356s21c1
Sequence:CCGGCATTTGGCAAGATGGATTATCCTCGAGGATAATCCATCTTGCCAAATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032148
SLC41A2 MISSION shRNA Lentiviral Transduction Particles
solute carrier family 41 (magnesium transporter), member 2
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000043949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032148.2-740s1c1
Sequence:CCGGCCTGCACTTCTTGGTCTCAAACTCGAGTTTGAGACCAAGAAGTGCAGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000043948    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032148.2-1662s1c1
Sequence:CCGGGCGCTGTGTTACAGGTATTTACTCGAGTAAATACCTGTAACACAGCGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000043950    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032148.2-1463s1c1
Sequence:CCGGCCAGGAGAATTGCCTGATGAACTCGAGTTCATCAGGCAATTCTCCTGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000422258    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032148.3-239s21c1
Sequence:CCGGAGATTGGACTTTACGTTTAAACTCGAGTTTAAACGTAAAGTCCAATCTTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000043951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032148.2-521s1c1
Sequence:CCGGGCCATGTTACAAGATGAAGATCTCGAGATCTTCATCTTGTAACATGGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000420325    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032148.3-1418s21c1
Sequence:CCGGTAATGGTATTGGTGGTAATTTCTCGAGAAATTACCACCAATACCATTATTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000420283    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032148.3-356s21c1
Sequence:CCGGCATTTGGCAAGATGGATTATCCTCGAGGATAATCCATCTTGCCAAATGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???