EMAIL THIS PAGE TO A FRIEND

SLC4A11

solute carrier family 4, sodium borate transporter, member 11

89 Gene Product Result for
Synonyms: BTR1 CDPD1 CHED2 NABC1 dJ794I6.2
Gene ID:
Human(83959) Summary: This gene encodes a voltage-regulated, electrogenic sodium-coupled borate cotransporter that is essential for borate homeostasis, cell growth and cell proliferation. Mutations in this gene have been associated with a number of endothelial corneal dystrophies including recessive corneal endothelial dystrophy 2, corneal dystrophy and perceptive deafness, and Fuchs endothelial corneal dystrophy. Multiple transcript variants encoding different isoforms have been described. [provided by RefSeq, Mar 2010]
Mouse(269356) solute carrier family 4, sodium bicarbonate transporter-like, member 11
Rat(311423) solute carrier family 4, sodium borate transporter, member 11
Zebrafish(559346) solute carrier family 4, sodium borate transporter, member 11
dog(485796) solute carrier family 4, sodium borate transporter, member 11
Horse(100066656) solute carrier family 4, sodium borate transporter, member 11
domestic cat(101095814) solute carrier family 4, sodium borate transporter, member 11
chicken(422943) solute carrier family 4, sodium borate transporter, member 11
cow(532407) solute carrier family 4, sodium borate transporter, member 11
sheep(101121698) solute carrier family 4, sodium borate transporter, member 11
naked mole-rat(101722839) solute carrier family 4, sodium borate transporter, member 11
domestic guinea pig(100715443) solute carrier family 4, sodium borate transporter, member 11
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032034 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032034 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032034 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001081162 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081162 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081162 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032034 Rosetta Predictions human pricing
NM_001107775 Rosetta Predictions rat pricing
NM_001081162 Rosetta Predictions mouse pricing
XM_194050 Rosetta Predictions mouse pricing
XM_901937 Rosetta Predictions mouse pricing
XM_901942 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032034 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00145413 predicted 1589
2 SASI_Hs01_00145414 predicted 1604
3 SASI_Hs01_00145415 predicted 1520
4 SASI_Hs02_00359231 predicted 1925
5 SASI_Hs01_00145416 predicted 2674
6 SASI_Hs01_00145417 predicted 877
7 SASI_Hs01_00145418 predicted 1120
8 SASI_Hs01_00145419 predicted 377
9 SASI_Hs01_00145420 predicted 1907
10 SASI_Hs01_00145421 predicted 532
11 SASI_Hs01_00145422 predicted 1373
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107775 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00232145 predicted 329
2 SASI_Rn02_00232146 predicted 1900
3 SASI_Rn02_00232147 predicted 1912
4 SASI_Rn02_00232148 predicted 1510
5 SASI_Rn02_00232149 predicted 493
6 SASI_Rn02_00232150 predicted 476
7 SASI_Rn02_00232151 predicted 505
8 SASI_Rn02_00232152 predicted 1114
9 SASI_Rn02_00232153 predicted 340
10 SASI_Rn02_00232154 predicted 1521
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081162 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00295791 predicted 837
2 SASI_Mm02_00295792 predicted 2541
3 SASI_Mm02_00295793 predicted 643
4 SASI_Mm02_00295794 predicted 621
5 SASI_Mm02_00295795 predicted 1662
6 SASI_Mm02_00295796 predicted 1252
7 SASI_Mm02_00295797 predicted 2430
8 SASI_Mm02_00295798 predicted 1536
9 SASI_Mm02_00295799 predicted 1676
10 SASI_Mm02_00295800 predicted 2645
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_194050 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00207077 predicted 2551
2 SASI_Mm01_00207078 predicted 648
3 SASI_Mm01_00207079 predicted 635
4 SASI_Mm01_00207080 predicted 1669
5 SASI_Mm01_00207081 predicted 1252
6 SASI_Mm01_00207082 predicted 2436
7 SASI_Mm01_00207083 predicted 1534
8 SASI_Mm01_00207084 predicted 2651
9 SASI_Mm01_00207085 predicted 2422
10 SASI_Mm01_00207086 predicted 670
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_901937 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00235316 predicted 2395
2 SASI_Mm01_00235317 predicted 2274
3 SASI_Mm01_00235318 predicted 2218
4 SASI_Mm01_00235319 predicted 2508
5 SASI_Mm01_00235320 predicted 2448
6 SASI_Mm01_00235321 predicted 2452
7 SASI_Mm01_00235322 predicted 2449
8 SASI_Mm01_00235323 predicted 2430
9 SASI_Mm01_00235324 predicted 2226
10 SASI_Mm01_00235325 predicted 2363
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_901942 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00261682 predicted 2390
2 SASI_Mm01_00261683 predicted 498
3 SASI_Mm01_00261684 predicted 477
4 SASI_Mm01_00261685 predicted 1514
5 SASI_Mm01_00261686 predicted 1097
6 SASI_Mm01_00261687 predicted 2272
7 SASI_Mm01_00261688 predicted 1385
8 SASI_Mm01_00261689 predicted 1518
9 SASI_Mm01_00261690 predicted 2489
10 SASI_Mm01_00261691 predicted 2263
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032034
VALIDATED
SLC4A11 MISSION shRNA Bacterial Glycerol Stock
solute carrier family 4, sodium borate transporter, member 11
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000038264    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_032034.1-2602s1c1
Sequence:CCGGCCCTACATGAAGATGATCTTTCTCGAGAAAGATCATCTTCATGTAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038268    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032034.1-1363s1c1
Sequence:CCGGGCGCTCTACATCCAGGTGATTCTCGAGAATCACCTGGATGTAGAGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038267    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032034.1-380s1c1
Sequence:CCGGCCCGAAAGTACCTGAAGTTAACTCGAGTTAACTTCAGGTACTTTCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038265    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032034.1-174s1c1
Sequence:CCGGCGAGGATTCAAGCTACTACAACTCGAGTTGTAGTAGCTTGAATCCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038266    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032034.1-2271s1c1
Sequence:CCGGCGGACACATCTATGACACGATCTCGAGATCGTGTCATAGATGTGTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428654    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032034.2-1451s21c1
Sequence:CCGGGTTTCTTCCTTGCGCTTTATGCTCGAGCATAAAGCGCAAGGAAGAAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421782    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032034.2-1126s21c1
Sequence:CCGGGACTTCACTGATGGCATTATTCTCGAGAATAATGCCATCAGTGAAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415148    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032034.2-1607s21c1
Sequence:CCGGGGCATTACTTGGACGACTATCCTCGAGGATAGTCGTCCAAGTAATGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418938    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032034.2-1564s21c1
Sequence:CCGGGCCGTCAAGGGCACGGTTAAACTCGAGTTTAACCGTGCCCTTGACGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032034
VALIDATED
SLC4A11 MISSION shRNA shRNA Plasmid DNA
solute carrier family 4, sodium borate transporter, member 11
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000038264    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_032034.1-2602s1c1
Sequence:CCGGCCCTACATGAAGATGATCTTTCTCGAGAAAGATCATCTTCATGTAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000038268    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032034.1-1363s1c1
Sequence:CCGGGCGCTCTACATCCAGGTGATTCTCGAGAATCACCTGGATGTAGAGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000038267    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032034.1-380s1c1
Sequence:CCGGCCCGAAAGTACCTGAAGTTAACTCGAGTTAACTTCAGGTACTTTCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000038265    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032034.1-174s1c1
Sequence:CCGGCGAGGATTCAAGCTACTACAACTCGAGTTGTAGTAGCTTGAATCCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000038266    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032034.1-2271s1c1
Sequence:CCGGCGGACACATCTATGACACGATCTCGAGATCGTGTCATAGATGTGTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428654    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032034.2-1451s21c1
Sequence:CCGGGTTTCTTCCTTGCGCTTTATGCTCGAGCATAAAGCGCAAGGAAGAAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421782    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032034.2-1126s21c1
Sequence:CCGGGACTTCACTGATGGCATTATTCTCGAGAATAATGCCATCAGTGAAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415148    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032034.2-1607s21c1
Sequence:CCGGGGCATTACTTGGACGACTATCCTCGAGGATAGTCGTCCAAGTAATGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418938    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032034.2-1564s21c1
Sequence:CCGGGCCGTCAAGGGCACGGTTAAACTCGAGTTTAACCGTGCCCTTGACGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032034
VALIDATED
SLC4A11 MISSION shRNA Lentiviral Transduction Particles
solute carrier family 4, sodium borate transporter, member 11
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000038264    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_032034.1-2602s1c1
Sequence:CCGGCCCTACATGAAGATGATCTTTCTCGAGAAAGATCATCTTCATGTAGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000038268    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032034.1-1363s1c1
Sequence:CCGGGCGCTCTACATCCAGGTGATTCTCGAGAATCACCTGGATGTAGAGCGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000038267    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032034.1-380s1c1
Sequence:CCGGCCCGAAAGTACCTGAAGTTAACTCGAGTTAACTTCAGGTACTTTCGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000038265    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032034.1-174s1c1
Sequence:CCGGCGAGGATTCAAGCTACTACAACTCGAGTTGTAGTAGCTTGAATCCTCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000038266    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032034.1-2271s1c1
Sequence:CCGGCGGACACATCTATGACACGATCTCGAGATCGTGTCATAGATGTGTCCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428654    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032034.2-1451s21c1
Sequence:CCGGGTTTCTTCCTTGCGCTTTATGCTCGAGCATAAAGCGCAAGGAAGAAACTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421782    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032034.2-1126s21c1
Sequence:CCGGGACTTCACTGATGGCATTATTCTCGAGAATAATGCCATCAGTGAAGTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415148    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032034.2-1607s21c1
Sequence:CCGGGGCATTACTTGGACGACTATCCTCGAGGATAGTCGTCCAAGTAATGCCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418938    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032034.2-1564s21c1
Sequence:CCGGGCCGTCAAGGGCACGGTTAAACTCGAGTTTAACCGTGCCCTTGACGGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081162
VALIDATED
SLC4A11 MISSION shRNA Bacterial Glycerol Stock
solute carrier family 4, sodium borate transporter, member 11
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000267593    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081162.1-2095s21c1
Sequence:CCGGGATGAGCAAGTTCCGGTATAACTCGAGTTATACCGGAACTTGCTCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252781    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081162.1-653s21c1
Sequence:CCGGGATGATGTCCTCCGAACTATGCTCGAGCATAGTTCGGAGGACATCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252783    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081162.1-2905s21c1
Sequence:CCGGGCCTGCTCTGTGGCAACATATCTCGAGATATGTTGCCACAGAGCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252782    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081162.1-2413s21c1
Sequence:CCGGCGTGGAGAATGGGCACATTTACTCGAGTAAATGTGCCCATTCTCCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252780    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081162.1-1731s21c1
Sequence:CCGGTCTTCGGGAAGTACTACTATGCTCGAGCATAGTAGTACTTCCCGAAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081162
VALIDATED
SLC4A11 MISSION shRNA shRNA Plasmid DNA
solute carrier family 4, sodium borate transporter, member 11
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000267593    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081162.1-2095s21c1
Sequence:CCGGGATGAGCAAGTTCCGGTATAACTCGAGTTATACCGGAACTTGCTCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252781    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081162.1-653s21c1
Sequence:CCGGGATGATGTCCTCCGAACTATGCTCGAGCATAGTTCGGAGGACATCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252783    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081162.1-2905s21c1
Sequence:CCGGGCCTGCTCTGTGGCAACATATCTCGAGATATGTTGCCACAGAGCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252782    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081162.1-2413s21c1
Sequence:CCGGCGTGGAGAATGGGCACATTTACTCGAGTAAATGTGCCCATTCTCCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252780    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081162.1-1731s21c1
Sequence:CCGGTCTTCGGGAAGTACTACTATGCTCGAGCATAGTAGTACTTCCCGAAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081162
VALIDATED
SLC4A11 MISSION shRNA Lentiviral Transduction Particles
solute carrier family 4, sodium borate transporter, member 11
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000267593    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081162.1-2095s21c1
Sequence:CCGGGATGAGCAAGTTCCGGTATAACTCGAGTTATACCGGAACTTGCTCATCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252781    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081162.1-653s21c1
Sequence:CCGGGATGATGTCCTCCGAACTATGCTCGAGCATAGTTCGGAGGACATCATCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252783    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081162.1-2905s21c1
Sequence:CCGGGCCTGCTCTGTGGCAACATATCTCGAGATATGTTGCCACAGAGCAGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252782    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081162.1-2413s21c1
Sequence:CCGGCGTGGAGAATGGGCACATTTACTCGAGTAAATGTGCCCATTCTCCACGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252780    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081162.1-1731s21c1
Sequence:CCGGTCTTCGGGAAGTACTACTATGCTCGAGCATAGTAGTACTTCCCGAAGATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)