EMAIL THIS PAGE TO A FRIEND

SLC4A1

solute carrier family 4 (anion exchanger), member 1

45 Gene Product Result for
Synonyms: AE1 BND3 CD233 DI EMPB3 EPB3 FR RTA1A SW WD WD1 WR
Gene ID:
Human(6521) Summary: The protein encoded by this gene is part of the anion exchanger (AE) family and is expressed in the erythrocyte plasma membrane, where it functions as a chloride/bicarbonate exchanger involved in carbon dioxide transport from tissues to lungs. The protein comprises two domains that are structurally and functionally distinct. The N-terminal 40kDa domain is located in the cytoplasm and acts as an attachment site for the red cell skeleton by binding ankyrin. The glycosylated C-terminal membrane-associated domain contains 12-14 membrane spanning segments and carries out the stilbene disulphonate-sensitive exchange transport of anions. The cytoplasmic tail at the extreme C-terminus of the membrane domain binds carbonic anhydrase II. The encoded protein associates with the red cell membrane protein glycophorin A and this association promotes the correct folding and translocation of the exchanger. This protein is predominantly dimeric but forms tetramers in the presence of ankyrin. Many mutations in this gene are known in man, and these mutations can lead to two types of disease: destabilization of red cell membrane leading to hereditary spherocytosis, and defective kidney acid secretion leading to distal renal tubular acidosis. Other mutations that do not give rise to disease result in novel blood group antigens, which form the Diego blood group system. Southeast Asian ovalocytosis (SAO, Melanesian ovalocytosis) results from the heterozygous presence of a deletion in the encoded protein and is common in areas where Plasmodium falciparum malaria is endemic. One null mutation in this gene is known, resulting in very severe anemia and nephrocalcinosis. [provided by RefSeq, Jul 2008]
Mouse(20533) solute carrier family 4 (anion exchanger), member 1
Rat(24779) solute carrier family 4 (anion exchanger), member 1
chicken(396532) solute carrier family 4, anion exchanger, member 1
Horse(100009691) solute carrier family 4, anion exchanger, member 1 (erythrocyte membrane protein band 3, Diego blood group)
domestic cat(101099413) solute carrier family 4, anion exchanger, member 1 (erythrocyte membrane protein band 3, Diego blood group)
dog(490939) solute carrier family 4, anion exchanger, member 1 (erythrocyte membrane protein band 3, Diego blood group)
cow(286817) solute carrier family 4, anion exchanger, member 1 (erythrocyte membrane protein band 3, Diego blood group)
sheep(101114627) solute carrier family 4, anion exchanger, member 1 (erythrocyte membrane protein band 3, Diego blood group)
naked mole-rat(101719082) solute carrier family 4, anion exchanger, member 1 (erythrocyte membrane protein band 3, Diego blood group)
Domestic Rabbit(100349024) solute carrier family 4, anion exchanger, member 1 (erythrocyte membrane protein band 3, Diego blood group)
domestic guinea pig(100728784) solute carrier family 4, anion exchanger, member 1 (erythrocyte membrane protein band 3, Diego blood group)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000342 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000342 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000342 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011403 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011403 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011403 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000342 Rosetta Predictions human pricing
NM_012651 Rosetta Predictions rat pricing
NM_011403 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000342 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00225354 predicted 1217
2 SASI_Hs01_00225356 predicted 1884
3 SASI_Hs01_00225358 predicted 1747
4 SASI_Hs01_00225359 predicted 1900
5 SASI_Hs01_00225360 predicted 1692
6 SASI_Hs01_00225361 predicted 1789
7 SASI_Hs02_00302373 predicted 490
8 SASI_Hs01_00225362 predicted 925
9 SASI_Hs02_00302374 predicted 2032
10 SASI_Hs01_00225363 predicted 1330
11 SASI_Hs01_00225355 predicted 1764
12 SASI_Hs01_00225357 predicted 1637
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012651 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00077396 predicted 1433
2 SASI_Rn01_00077397 predicted 1700
3 SASI_Rn02_00259899 predicted 676
4 SASI_Rn01_00077399 predicted 2727
5 SASI_Rn01_00077400 predicted 1109
6 SASI_Rn02_00259900 predicted 2245
7 SASI_Rn01_00077402 predicted 652
8 SASI_Rn01_00077403 predicted 1312
9 SASI_Rn01_00077404 predicted 1443
10 SASI_Rn01_00077405 predicted 1174
11 SASI_Rn01_00077398 predicted 1748
12 SASI_Rn01_00077401 predicted 2017
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011403 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00174498 predicted 1349
2 SASI_Mm01_00174499 predicted 1937
3 SASI_Mm01_00174500 predicted 2595
4 SASI_Mm01_00174501 predicted 213
5 SASI_Mm01_00174502 predicted 569
6 SASI_Mm01_00174503 predicted 1230
7 SASI_Mm01_00174504 predicted 204
8 SASI_Mm01_00174505 predicted 1788
9 SASI_Mm01_00174506 predicted 1031
10 SASI_Mm01_00174507 predicted 2790
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000342
SLC4A1 MISSION shRNA Bacterial Glycerol Stock
solute carrier family 4 (anion exchanger), member 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000432226    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000342.3-1994s21c1
Sequence:CCGGGATCATGGTCCTGGTGGATTTCTCGAGAAATCCACCAGGACCATGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420421    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000342.3-1224s21c1
Sequence:CCGGTACAAGGGCCTAGACTTAAATCTCGAGATTTAAGTCTAGGCCCTTGTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044768    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000342.1-1752s1c1
Sequence:CCGGCCACCCACTACAGAAGACTTACTCGAGTAAGTCTTCTGTAGTGGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044769    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000342.1-513s1c1
Sequence:CCGGCCAACTGCTAGACAGGTTTATCTCGAGATAAACCTGTCTAGCAGTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044772    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000342.1-451s1c1
Sequence:CCGGGTCTTCACCAAGGGTACTGTTCTCGAGAACAGTACCCTTGGTGAAGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044770    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000342.1-1884s1c1
Sequence:CCGGGTTCAAGAACAGCTCCTATTTCTCGAGAAATAGGAGCTGTTCTTGAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000342.1-2478s1c1
Sequence:CCGGGTTTGGCATCTTCCTCTACATCTCGAGATGTAGAGGAAGATGCCAAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417343    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000342.3-3350s21c1
Sequence:CCGGAGGACCAAAGATACATGTAAACTCGAGTTTACATGTATCTTTGGTCCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000342
SLC4A1 MISSION shRNA shRNA Plasmid DNA
solute carrier family 4 (anion exchanger), member 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000432226    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000342.3-1994s21c1
Sequence:CCGGGATCATGGTCCTGGTGGATTTCTCGAGAAATCCACCAGGACCATGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420421    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000342.3-1224s21c1
Sequence:CCGGTACAAGGGCCTAGACTTAAATCTCGAGATTTAAGTCTAGGCCCTTGTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044768    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000342.1-1752s1c1
Sequence:CCGGCCACCCACTACAGAAGACTTACTCGAGTAAGTCTTCTGTAGTGGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044769    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000342.1-513s1c1
Sequence:CCGGCCAACTGCTAGACAGGTTTATCTCGAGATAAACCTGTCTAGCAGTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044772    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000342.1-451s1c1
Sequence:CCGGGTCTTCACCAAGGGTACTGTTCTCGAGAACAGTACCCTTGGTGAAGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044770    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000342.1-1884s1c1
Sequence:CCGGGTTCAAGAACAGCTCCTATTTCTCGAGAAATAGGAGCTGTTCTTGAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000342.1-2478s1c1
Sequence:CCGGGTTTGGCATCTTCCTCTACATCTCGAGATGTAGAGGAAGATGCCAAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417343    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000342.3-3350s21c1
Sequence:CCGGAGGACCAAAGATACATGTAAACTCGAGTTTACATGTATCTTTGGTCCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000342
SLC4A1 MISSION shRNA Lentiviral Transduction Particles
solute carrier family 4 (anion exchanger), member 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000432226    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000342.3-1994s21c1
Sequence:CCGGGATCATGGTCCTGGTGGATTTCTCGAGAAATCCACCAGGACCATGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420421    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000342.3-1224s21c1
Sequence:CCGGTACAAGGGCCTAGACTTAAATCTCGAGATTTAAGTCTAGGCCCTTGTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044768    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000342.1-1752s1c1
Sequence:CCGGCCACCCACTACAGAAGACTTACTCGAGTAAGTCTTCTGTAGTGGGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044769    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000342.1-513s1c1
Sequence:CCGGCCAACTGCTAGACAGGTTTATCTCGAGATAAACCTGTCTAGCAGTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044772    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000342.1-451s1c1
Sequence:CCGGGTCTTCACCAAGGGTACTGTTCTCGAGAACAGTACCCTTGGTGAAGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044770    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000342.1-1884s1c1
Sequence:CCGGGTTCAAGAACAGCTCCTATTTCTCGAGAAATAGGAGCTGTTCTTGAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000342.1-2478s1c1
Sequence:CCGGGTTTGGCATCTTCCTCTACATCTCGAGATGTAGAGGAAGATGCCAAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417343    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000342.3-3350s21c1
Sequence:CCGGAGGACCAAAGATACATGTAAACTCGAGTTTACATGTATCTTTGGTCCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011403
SLC4A1 MISSION shRNA Bacterial Glycerol Stock
solute carrier family 4 (anion exchanger), member 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000069782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011403.1-1231s1c1
Sequence:CCGGCCCAACTTGTACAACACTCTACTCGAGTAGAGTGTTGTACAAGTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011403.1-2034s1c1
Sequence:CCGGCCTGGTGGATTCCTTCATCAACTCGAGTTGATGAAGGAATCCACCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069779    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011403.1-1719s1c1
Sequence:CCGGCGTCCAATACATCTCCCGATACTCGAGTATCGGGAGATGTATTGGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011403.1-193s1c1
Sequence:CCGGGAGAACATAATAGGACAGATACTCGAGTATCTGTCCTATTATGTTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069778    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011403.1-3606s1c1
Sequence:CCGGCCCACTAAGTATTCATTCATTCTCGAGAATGAATGAATACTTAGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436653    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011403.2-3132s21c1
Sequence:CCGGGACCACTCATGGGCGTGTTATCTCGAGATAACACGCCCATGAGTGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434072    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011403.2-1791s21c1
Sequence:CCGGAGCAATAACCTGGAGTATATCCTCGAGGATATACTCCAGGTTATTGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418935    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011403.2-3313s21c1
Sequence:CCGGCTCTTCATGGCATAGTTATAACTCGAGTTATAACTATGCCATGAAGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421027    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011403.2-1147s21c1
Sequence:CCGGAGGCTCCGCATGTCGACTATACTCGAGTATAGTCGACATGCGGAGCCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011403
SLC4A1 MISSION shRNA shRNA Plasmid DNA
solute carrier family 4 (anion exchanger), member 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000069782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011403.1-1231s1c1
Sequence:CCGGCCCAACTTGTACAACACTCTACTCGAGTAGAGTGTTGTACAAGTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011403.1-2034s1c1
Sequence:CCGGCCTGGTGGATTCCTTCATCAACTCGAGTTGATGAAGGAATCCACCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069779    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011403.1-1719s1c1
Sequence:CCGGCGTCCAATACATCTCCCGATACTCGAGTATCGGGAGATGTATTGGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011403.1-193s1c1
Sequence:CCGGGAGAACATAATAGGACAGATACTCGAGTATCTGTCCTATTATGTTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069778    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011403.1-3606s1c1
Sequence:CCGGCCCACTAAGTATTCATTCATTCTCGAGAATGAATGAATACTTAGTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000436653    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011403.2-3132s21c1
Sequence:CCGGGACCACTCATGGGCGTGTTATCTCGAGATAACACGCCCATGAGTGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434072    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011403.2-1791s21c1
Sequence:CCGGAGCAATAACCTGGAGTATATCCTCGAGGATATACTCCAGGTTATTGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418935    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011403.2-3313s21c1
Sequence:CCGGCTCTTCATGGCATAGTTATAACTCGAGTTATAACTATGCCATGAAGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421027    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011403.2-1147s21c1
Sequence:CCGGAGGCTCCGCATGTCGACTATACTCGAGTATAGTCGACATGCGGAGCCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011403
SLC4A1 MISSION shRNA Lentiviral Transduction Particles
solute carrier family 4 (anion exchanger), member 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000069782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011403.1-1231s1c1
Sequence:CCGGCCCAACTTGTACAACACTCTACTCGAGTAGAGTGTTGTACAAGTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011403.1-2034s1c1
Sequence:CCGGCCTGGTGGATTCCTTCATCAACTCGAGTTGATGAAGGAATCCACCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069779    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011403.1-1719s1c1
Sequence:CCGGCGTCCAATACATCTCCCGATACTCGAGTATCGGGAGATGTATTGGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011403.1-193s1c1
Sequence:CCGGGAGAACATAATAGGACAGATACTCGAGTATCTGTCCTATTATGTTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069778    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011403.1-3606s1c1
Sequence:CCGGCCCACTAAGTATTCATTCATTCTCGAGAATGAATGAATACTTAGTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436653    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011403.2-3132s21c1
Sequence:CCGGGACCACTCATGGGCGTGTTATCTCGAGATAACACGCCCATGAGTGGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434072    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011403.2-1791s21c1
Sequence:CCGGAGCAATAACCTGGAGTATATCCTCGAGGATATACTCCAGGTTATTGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418935    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011403.2-3313s21c1
Sequence:CCGGCTCTTCATGGCATAGTTATAACTCGAGTTATAACTATGCCATGAAGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421027    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011403.2-1147s21c1
Sequence:CCGGAGGCTCCGCATGTCGACTATACTCGAGTATAGTCGACATGCGGAGCCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)