EMAIL THIS PAGE TO A FRIEND

SLC50A1

solute carrier family 50 (sugar efflux transporter), member 1

89 Gene Product Result for
Synonyms: HsSWEET1 RAG1AP1 SCP SWEET1 slv
UniProtKB ID: Q9BRV3, Q5SR64, Q6IAK6, Q96DC5, Q9UHQ2, Q9UHQ3
Gene ID:
Mouse(19729) solute carrier family 50 (sugar transporter), member 1
Rat(295245) solute carrier family 50 (sugar efflux transporter), member 1
Zebrafish(503533) solute carrier family 50 (sugar transporter), member 1
dog(480132) solute carrier family 50 (sugar transporter), member 1
domestic cat(101094324) solute carrier family 50 (sugar transporter), member 1
domestic guinea pig(100714420) solute carrier family 50 (sugar transporter), member 1
naked mole-rat(101708903) solute carrier family 50 (sugar transporter), member 1
cow(520463) solute carrier family 50 (sugar efflux transporter), member 1
sheep(101115842) solute carrier family 50 (sugar transporter), member 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009057 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009057 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009057 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_018845 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018845 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018845 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001122837 Rosetta Predictions human pricing
NM_001122839 Rosetta Predictions human pricing
NM_018845 Rosetta Predictions human pricing
NM_001106445 Rosetta Predictions rat pricing
NM_009057 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001122837 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00327447 predicted 553
2 SASI_Hs02_00327448 predicted 346
3 SASI_Hs02_00327449 predicted 425
4 SASI_Hs02_00327450 predicted 417
5 SASI_Hs02_00327451 predicted 656
6 SASI_Hs02_00327452 predicted 373
7 SASI_Hs02_00327453 predicted 563
8 SASI_Hs02_00327454 predicted 569
9 SASI_Hs02_00327455 predicted 201
10 SASI_Hs02_00327456 predicted 364
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001122839 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00327467 predicted 509
2 SASI_Hs02_00327468 predicted 312
3 SASI_Hs02_00327469 predicted 612
4 SASI_Hs02_00327470 predicted 458
5 SASI_Hs02_00327471 predicted 330
6 SASI_Hs02_00327472 predicted 293
7 SASI_Hs02_00327473 predicted 277
8 SASI_Hs02_00327474 predicted 205
9 SASI_Hs02_00327475 predicted 587
10 SASI_Hs02_00327476 predicted 234
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018845 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00084739 predicted 676
2 SASI_Hs01_00084740 predicted 374
3 SASI_Hs02_00352299 predicted 465
4 SASI_Hs02_00352300 predicted 549
5 SASI_Hs01_00084745 predicted 542
6 SASI_Hs02_00352301 predicted 783
7 SASI_Hs01_00084746 predicted 279
8 SASI_Hs01_00084747 predicted 683
9 SASI_Hs02_00352302 predicted 690
10 SASI_Hs02_00352303 predicted 207
11 SASI_Hs01_00084741 predicted 283
12 SASI_Hs01_00084742 predicted 585
13 SASI_Hs01_00084743 predicted 291
14 SASI_Hs01_00084744 predicted 257
15 SASI_Hs01_00084748 predicted 501
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106445 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00219028 predicted 527
2 SASI_Rn02_00219029 predicted 329
3 SASI_Rn02_00219030 predicted 537
4 SASI_Rn02_00219031 predicted 709
5 SASI_Rn02_00219032 predicted 464
6 SASI_Rn02_00219033 predicted 319
7 SASI_Rn02_00219034 predicted 535
8 SASI_Rn02_00219035 predicted 681
9 SASI_Rn02_00219036 predicted 533
10 SASI_Rn02_00219037 predicted 685
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009057 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00052070 predicted 544
2 SASI_Mm02_00315224 predicted 543
3 SASI_Mm01_00052071 predicted 591
4 SASI_Mm02_00315225 predicted 490
5 SASI_Mm02_00315226 predicted 484
6 SASI_Mm01_00052072 predicted 328
7 SASI_Mm01_00052073 predicted 290
8 SASI_Mm01_00052074 predicted 690
9 SASI_Mm01_00052075 predicted 273
10 SASI_Mm02_00315227 predicted 350
11 SASI_Mm01_00052067 predicted 713
12 SASI_Mm01_00052068 predicted 501
13 SASI_Mm01_00052069 predicted 681
14 SASI_Mm01_00052076 predicted 480
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009057
VALIDATED
SLC50A1 MISSION shRNA Bacterial Glycerol Stock
solute carrier family 50 (sugar efflux transporter), member 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000437057    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009057.3-685s21c1
Sequence:CCGGGGAATCCTCACCAGCTTAATCCTCGAGGATTAAGCTGGTGAGGATTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432173    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009057.3-617s21c1
Sequence:CCGGGCTCCGCCTCTTGGTCTATTTCTCGAGAAATAGACCAAGAGGCGGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417224    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009057.3-305s21c1
Sequence:CCGGGGACCCTTATCATCGTCAATACTCGAGTATTGACGATGATAAGGGTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437124    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009057.3-835s21c1
Sequence:CCGGCCAGTTCCATGGATGCAATAGCTCGAGCTATTGCATCCATGGAACTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125145    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009057.1-541s1c1
Sequence:CCGGGCCAAGATCGTTCAGACTAAACTCGAGTTTAGTCTGAACGATCTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125148    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009057.1-267s1c1
Sequence:CCGGGCTGAGTTACGGAGTCTTGAACTCGAGTTCAAGACTCCGTAACTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125147    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009057.1-336s1c1
Sequence:CCGGGACTCTTTATATCCTGGCATACTCGAGTATGCCAGGATATAAAGAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125146    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009057.1-485s1c1
Sequence:CCGGGCCTCTTCTGTAGCGTCTTTACTCGAGTAAAGACGCTACAGAAGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125144    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009057.1-775s1c1
Sequence:CCGGGAGTGCCAACTGGATACCAAACTCGAGTTTGGTATCCAGTTGGCACTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009057
VALIDATED
SLC50A1 MISSION shRNA shRNA Plasmid DNA
solute carrier family 50 (sugar efflux transporter), member 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000437057    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009057.3-685s21c1
Sequence:CCGGGGAATCCTCACCAGCTTAATCCTCGAGGATTAAGCTGGTGAGGATTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000432173    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009057.3-617s21c1
Sequence:CCGGGCTCCGCCTCTTGGTCTATTTCTCGAGAAATAGACCAAGAGGCGGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417224    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009057.3-305s21c1
Sequence:CCGGGGACCCTTATCATCGTCAATACTCGAGTATTGACGATGATAAGGGTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437124    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009057.3-835s21c1
Sequence:CCGGCCAGTTCCATGGATGCAATAGCTCGAGCTATTGCATCCATGGAACTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000125145    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009057.1-541s1c1
Sequence:CCGGGCCAAGATCGTTCAGACTAAACTCGAGTTTAGTCTGAACGATCTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000125148    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009057.1-267s1c1
Sequence:CCGGGCTGAGTTACGGAGTCTTGAACTCGAGTTCAAGACTCCGTAACTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000125147    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009057.1-336s1c1
Sequence:CCGGGACTCTTTATATCCTGGCATACTCGAGTATGCCAGGATATAAAGAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000125146    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009057.1-485s1c1
Sequence:CCGGGCCTCTTCTGTAGCGTCTTTACTCGAGTAAAGACGCTACAGAAGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000125144    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009057.1-775s1c1
Sequence:CCGGGAGTGCCAACTGGATACCAAACTCGAGTTTGGTATCCAGTTGGCACTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009057
VALIDATED
SLC50A1 MISSION shRNA Lentiviral Transduction Particles
solute carrier family 50 (sugar efflux transporter), member 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000437057    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009057.3-685s21c1
Sequence:CCGGGGAATCCTCACCAGCTTAATCCTCGAGGATTAAGCTGGTGAGGATTCCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000432173    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009057.3-617s21c1
Sequence:CCGGGCTCCGCCTCTTGGTCTATTTCTCGAGAAATAGACCAAGAGGCGGAGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417224    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009057.3-305s21c1
Sequence:CCGGGGACCCTTATCATCGTCAATACTCGAGTATTGACGATGATAAGGGTCCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437124    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009057.3-835s21c1
Sequence:CCGGCCAGTTCCATGGATGCAATAGCTCGAGCTATTGCATCCATGGAACTGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000125145    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009057.1-541s1c1
Sequence:CCGGGCCAAGATCGTTCAGACTAAACTCGAGTTTAGTCTGAACGATCTTGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000125148    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009057.1-267s1c1
Sequence:CCGGGCTGAGTTACGGAGTCTTGAACTCGAGTTCAAGACTCCGTAACTCAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000125147    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009057.1-336s1c1
Sequence:CCGGGACTCTTTATATCCTGGCATACTCGAGTATGCCAGGATATAAAGAGTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000125146    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009057.1-485s1c1
Sequence:CCGGGCCTCTTCTGTAGCGTCTTTACTCGAGTAAAGACGCTACAGAAGAGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000125144    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009057.1-775s1c1
Sequence:CCGGGAGTGCCAACTGGATACCAAACTCGAGTTTGGTATCCAGTTGGCACTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018845
VALIDATED
SLC50A1 MISSION shRNA Bacterial Glycerol Stock
solute carrier family 50 (sugar efflux transporter), member 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000297498    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018845.3-1113s21c1
Sequence:CCGGCAACCTGACTAACATGGTGAACTCGAGTTCACCATGTTAGTCAGGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278525    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018845.3-693s21c1
Sequence:CCGGGCTTTATCCGCTTCTGGCTTTCTCGAGAAAGCCAGAAGCGGATAAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278527    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018845.3-869s21c1
Sequence:CCGGGTGGGAACAAGAGATGACTTTCTCGAGAAAGTCATCTCTTGTTCCCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278526    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018845.3-539s21c1
Sequence:CCGGGACTTGGCTAAGGTGATTCAACTCGAGTTGAATCACCTTAGCCAAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136758    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_018845.1-629s1c1
Sequence:CCGGCCAACTTTCCAGGAATCGTCACTCGAGTGACGATTCCTGGAAAGTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278540    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018845.3-669s21c1
Sequence:CCGGCCAACTTTCCAGGAATCGTCACTCGAGTGACGATTCCTGGAAAGTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137192    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_018845.1-653s1c1
Sequence:CCGGGCTTTATCCGCTTCTGGCTTTCTCGAGAAAGCCAGAAGCGGATAAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135443    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_018845.1-499s1c1
Sequence:CCGGGACTTGGCTAAGGTGATTCAACTCGAGTTGAATCACCTTAGCCAAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135689    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_018845.1-1073s1c1
Sequence:CCGGCAACCTGACTAACATGGTGAACTCGAGTTCACCATGTTAGTCAGGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135654    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_018845.1-829s1c1
Sequence:CCGGGTGGGAACAAGAGATGACTTTCTCGAGAAAGTCATCTCTTGTTCCCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018845
VALIDATED
SLC50A1 MISSION shRNA shRNA Plasmid DNA
solute carrier family 50 (sugar efflux transporter), member 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000297498    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018845.3-1113s21c1
Sequence:CCGGCAACCTGACTAACATGGTGAACTCGAGTTCACCATGTTAGTCAGGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278525    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018845.3-693s21c1
Sequence:CCGGGCTTTATCCGCTTCTGGCTTTCTCGAGAAAGCCAGAAGCGGATAAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278527    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018845.3-869s21c1
Sequence:CCGGGTGGGAACAAGAGATGACTTTCTCGAGAAAGTCATCTCTTGTTCCCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278526    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018845.3-539s21c1
Sequence:CCGGGACTTGGCTAAGGTGATTCAACTCGAGTTGAATCACCTTAGCCAAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136758    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_018845.1-629s1c1
Sequence:CCGGCCAACTTTCCAGGAATCGTCACTCGAGTGACGATTCCTGGAAAGTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278540    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018845.3-669s21c1
Sequence:CCGGCCAACTTTCCAGGAATCGTCACTCGAGTGACGATTCCTGGAAAGTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137192    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_018845.1-653s1c1
Sequence:CCGGGCTTTATCCGCTTCTGGCTTTCTCGAGAAAGCCAGAAGCGGATAAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135443    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_018845.1-499s1c1
Sequence:CCGGGACTTGGCTAAGGTGATTCAACTCGAGTTGAATCACCTTAGCCAAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135689    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_018845.1-1073s1c1
Sequence:CCGGCAACCTGACTAACATGGTGAACTCGAGTTCACCATGTTAGTCAGGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135654    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_018845.1-829s1c1
Sequence:CCGGGTGGGAACAAGAGATGACTTTCTCGAGAAAGTCATCTCTTGTTCCCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018845
VALIDATED
SLC50A1 MISSION shRNA Lentiviral Transduction Particles
solute carrier family 50 (sugar efflux transporter), member 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000297498    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018845.3-1113s21c1
Sequence:CCGGCAACCTGACTAACATGGTGAACTCGAGTTCACCATGTTAGTCAGGTTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278525    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018845.3-693s21c1
Sequence:CCGGGCTTTATCCGCTTCTGGCTTTCTCGAGAAAGCCAGAAGCGGATAAAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278527    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018845.3-869s21c1
Sequence:CCGGGTGGGAACAAGAGATGACTTTCTCGAGAAAGTCATCTCTTGTTCCCACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278526    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018845.3-539s21c1
Sequence:CCGGGACTTGGCTAAGGTGATTCAACTCGAGTTGAATCACCTTAGCCAAGTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136758    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_018845.1-629s1c1
Sequence:CCGGCCAACTTTCCAGGAATCGTCACTCGAGTGACGATTCCTGGAAAGTTGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278540    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018845.3-669s21c1
Sequence:CCGGCCAACTTTCCAGGAATCGTCACTCGAGTGACGATTCCTGGAAAGTTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137192    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_018845.1-653s1c1
Sequence:CCGGGCTTTATCCGCTTCTGGCTTTCTCGAGAAAGCCAGAAGCGGATAAAGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135443    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_018845.1-499s1c1
Sequence:CCGGGACTTGGCTAAGGTGATTCAACTCGAGTTGAATCACCTTAGCCAAGTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135689    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_018845.1-1073s1c1
Sequence:CCGGCAACCTGACTAACATGGTGAACTCGAGTTCACCATGTTAGTCAGGTTGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135654    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_018845.1-829s1c1
Sequence:CCGGGTGGGAACAAGAGATGACTTTCTCGAGAAAGTCATCTCTTGTTCCCACTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)