EMAIL THIS PAGE TO A FRIEND

SLC5A1

solute carrier family 5 (sodium/glucose cotransporter), member 1

95 Gene Product Result for
Synonyms: D22S675 NAGT SGLT1
UniProtKB ID: P13866, B2R7E2, B7Z4Q9, B7ZA69
Gene ID:
Human(6523) Summary: This gene encodes a member of the sodium-dependent glucose transporter (SGLT) family. The encoded integral membrane protein is the primary mediator of dietary glucose and galactose uptake from the intestinal lumen. Mutations in this gene have been associated with glucose-galactose malabsorption. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2012]
Mouse(20537) solute carrier family 5 (sodium/glucose cotransporter), member 1
Rat(25552) solute carrier family 5 (sodium/glucose cotransporter), member 1
Zebrafish(393654) solute carrier family 5 (sodium/glucose cotransporter), member 1
domestic cat(100500739) solute carrier family 5 (sodium/glucose cotransporter), member 1
Horse(100033952) solute carrier family 5 (sodium/glucose cotransporter), member 1
dog(492299) solute carrier family 5 (sodium/glucose cotransporter), member 1
chicken(395496) solute carrier family 5 (sodium/glucose cotransporter), member 1
cow(282361) solute carrier family 5 (sodium/glucose cotransporter), member 1
sheep(492300) solute carrier family 5 (sodium/glucose cotransporter), member 1
naked mole-rat(101710047) solute carrier family 5 (sodium/glucose cotransporter), member 1
Domestic Rabbit(100009262) solute carrier family 5 (sodium/glucose cotransporter), member 1
domestic guinea pig(100728093) solute carrier family 5 (sodium/glucose cotransporter), member 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000343 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000343 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000343 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_019810 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019810 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019810 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000343 Rosetta Predictions human pricing
NM_013033 Rosetta Predictions rat pricing
XM_579365 Rosetta Predictions rat pricing
NM_019810 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000343 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00070044 predicted 2080
2 SASI_Hs01_00070045 predicted 914
3 SASI_Hs01_00070047 predicted 1273
4 SASI_Hs01_00070049 predicted 241
5 SASI_Hs02_00302375 predicted 1798
6 SASI_Hs01_00070050 predicted 1916
7 SASI_Hs02_00302376 predicted 1765
8 SASI_Hs01_00070051 predicted 1445
9 SASI_Hs01_00070052 predicted 1750
10 SASI_Hs01_00070053 predicted 1249
11 SASI_Hs01_00070046 predicted 234
12 SASI_Hs01_00070048 predicted 2042
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013033 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00095027 predicted 1312
2 SASI_Rn01_00095028 predicted 1917
3 SASI_Rn01_00095029 predicted 549
4 SASI_Rn01_00095030 predicted 1757
5 SASI_Rn02_00260728 predicted 1629
6 SASI_Rn02_00260729 predicted 219
7 SASI_Rn01_00095032 predicted 1765
8 SASI_Rn01_00095033 predicted 910
9 SASI_Rn01_00095034 predicted 311
10 SASI_Rn01_00095036 predicted 2195
11 SASI_Rn01_00095031 predicted 1033
12 SASI_Rn01_00095035 predicted 214
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579365 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00149037 predicted 947
2 SASI_Rn01_00149038 predicted 946
3 SASI_Rn01_00149039 predicted 952
4 SASI_Rn01_00149040 predicted 963
5 SASI_Rn01_00149041 predicted 1276
6 SASI_Rn01_00149042 predicted 845
7 SASI_Rn01_00149043 predicted 519
8 SASI_Rn01_00149044 predicted 1136
9 SASI_Rn01_00149045 predicted 1036
10 SASI_Rn01_00149046 predicted 882
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019810 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00138470 predicted 742
2 SASI_Mm01_00138471 predicted 769
3 SASI_Mm01_00138472 predicted 812
4 SASI_Mm01_00138473 predicted 2291
5 SASI_Mm01_00138474 predicted 366
6 SASI_Mm01_00138475 predicted 1832
7 SASI_Mm01_00138476 predicted 1543
8 SASI_Mm01_00138477 predicted 1132
9 SASI_Mm01_00138478 predicted 939
10 SASI_Mm01_00138479 predicted 1370
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000343
SLC5A1 MISSION shRNA Bacterial Glycerol Stock
solute carrier family 5 (sodium/glucose cotransporter), member 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000431844    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000343.2-1926s21c1
Sequence:CCGGACAGCAAAGAGGAGCGTATTGCTCGAGCAATACGCTCCTCTTTGCTGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422685    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000343.2-2157s21c1
Sequence:CCGGGGACAGTGTTGAACGTCAATGCTCGAGCATTGACGTTCAACACTGTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000343.1-76s1c1
Sequence:CCGGCATTCGCAATGCAGCCGATATCTCGAGATATCGGCTGCATTGCGAATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426548    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000343.2-2039s21c1
Sequence:CCGGAGGAGAGCCTATGACCTATTTCTCGAGAAATAGGTCATAGGCTCTCCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043588    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000343.1-1612s1c1
Sequence:CCGGCGCCATTTCTTTCATCACCATCTCGAGATGGTGATGAAAGAAATGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000343.1-549s1c1
Sequence:CCGGCCATCTTTCTCTTATTGGCAACTCGAGTTGCCAATAAGAGAAAGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000343.1-1598s1c1
Sequence:CCGGGCCATTATCCTCTTCGCCATTCTCGAGAATGGCGAAGAGGATAATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043589    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000343.1-1051s1c1
Sequence:CCGGCCCTTCAGAATGTGAGAAATACTCGAGTATTTCTCACATTCTGAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000343
SLC5A1 MISSION shRNA shRNA Plasmid DNA
solute carrier family 5 (sodium/glucose cotransporter), member 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000431844    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000343.2-1926s21c1
Sequence:CCGGACAGCAAAGAGGAGCGTATTGCTCGAGCAATACGCTCCTCTTTGCTGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422685    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000343.2-2157s21c1
Sequence:CCGGGGACAGTGTTGAACGTCAATGCTCGAGCATTGACGTTCAACACTGTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000343.1-76s1c1
Sequence:CCGGCATTCGCAATGCAGCCGATATCTCGAGATATCGGCTGCATTGCGAATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426548    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000343.2-2039s21c1
Sequence:CCGGAGGAGAGCCTATGACCTATTTCTCGAGAAATAGGTCATAGGCTCTCCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043588    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000343.1-1612s1c1
Sequence:CCGGCGCCATTTCTTTCATCACCATCTCGAGATGGTGATGAAAGAAATGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000343.1-549s1c1
Sequence:CCGGCCATCTTTCTCTTATTGGCAACTCGAGTTGCCAATAAGAGAAAGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000343.1-1598s1c1
Sequence:CCGGGCCATTATCCTCTTCGCCATTCTCGAGAATGGCGAAGAGGATAATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043589    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000343.1-1051s1c1
Sequence:CCGGCCCTTCAGAATGTGAGAAATACTCGAGTATTTCTCACATTCTGAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000343
SLC5A1 MISSION shRNA Lentiviral Transduction Particles
solute carrier family 5 (sodium/glucose cotransporter), member 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000431844    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000343.2-1926s21c1
Sequence:CCGGACAGCAAAGAGGAGCGTATTGCTCGAGCAATACGCTCCTCTTTGCTGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422685    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000343.2-2157s21c1
Sequence:CCGGGGACAGTGTTGAACGTCAATGCTCGAGCATTGACGTTCAACACTGTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000343.1-76s1c1
Sequence:CCGGCATTCGCAATGCAGCCGATATCTCGAGATATCGGCTGCATTGCGAATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426548    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000343.2-2039s21c1
Sequence:CCGGAGGAGAGCCTATGACCTATTTCTCGAGAAATAGGTCATAGGCTCTCCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043588    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000343.1-1612s1c1
Sequence:CCGGCGCCATTTCTTTCATCACCATCTCGAGATGGTGATGAAAGAAATGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000343.1-549s1c1
Sequence:CCGGCCATCTTTCTCTTATTGGCAACTCGAGTTGCCAATAAGAGAAAGATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000343.1-1598s1c1
Sequence:CCGGGCCATTATCCTCTTCGCCATTCTCGAGAATGGCGAAGAGGATAATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043589    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000343.1-1051s1c1
Sequence:CCGGCCCTTCAGAATGTGAGAAATACTCGAGTATTTCTCACATTCTGAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019810
SLC5A1 MISSION shRNA Bacterial Glycerol Stock
solute carrier family 5 (sodium/glucose cotransporter), member 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000079913    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019810.2-3280s1c1
Sequence:CCGGGCCACAATGATTGGCTTGTAACTCGAGTTACAAGCCAATCATTGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000079916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019810.2-2157s1c1
Sequence:CCGGGTGGTGAACATCAACGGTATTCTCGAGAATACCGTTGATGTTCACCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000079914    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019810.2-562s1c1
Sequence:CCGGGCTGGATATTTGTCCCGATTTCTCGAGAAATCGGGACAAATATCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000079915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019810.2-1228s1c1
Sequence:CCGGGCCGGATTCTATATACAGAAACTCGAGTTTCTGTATATAGAATCCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000079917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019810.2-932s1c1
Sequence:CCGGCATGAAAGCTATTCCAACTAACTCGAGTTAGTTGGAATAGCTTTCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019810
SLC5A1 MISSION shRNA shRNA Plasmid DNA
solute carrier family 5 (sodium/glucose cotransporter), member 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000079913    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019810.2-3280s1c1
Sequence:CCGGGCCACAATGATTGGCTTGTAACTCGAGTTACAAGCCAATCATTGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000079916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019810.2-2157s1c1
Sequence:CCGGGTGGTGAACATCAACGGTATTCTCGAGAATACCGTTGATGTTCACCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000079914    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019810.2-562s1c1
Sequence:CCGGGCTGGATATTTGTCCCGATTTCTCGAGAAATCGGGACAAATATCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000079915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019810.2-1228s1c1
Sequence:CCGGGCCGGATTCTATATACAGAAACTCGAGTTTCTGTATATAGAATCCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000079917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019810.2-932s1c1
Sequence:CCGGCATGAAAGCTATTCCAACTAACTCGAGTTAGTTGGAATAGCTTTCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019810
SLC5A1 MISSION shRNA Lentiviral Transduction Particles
solute carrier family 5 (sodium/glucose cotransporter), member 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000079913    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019810.2-3280s1c1
Sequence:CCGGGCCACAATGATTGGCTTGTAACTCGAGTTACAAGCCAATCATTGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000079916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019810.2-2157s1c1
Sequence:CCGGGTGGTGAACATCAACGGTATTCTCGAGAATACCGTTGATGTTCACCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000079914    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019810.2-562s1c1
Sequence:CCGGGCTGGATATTTGTCCCGATTTCTCGAGAAATCGGGACAAATATCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000079915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019810.2-1228s1c1
Sequence:CCGGGCCGGATTCTATATACAGAAACTCGAGTTTCTGTATATAGAATCCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000079917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019810.2-932s1c1
Sequence:CCGGCATGAAAGCTATTCCAACTAACTCGAGTTAGTTGGAATAGCTTTCATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)