EMAIL THIS PAGE TO A FRIEND

SLC5A4

solute carrier family 5 (glucose activated ion channel), member 4

23 Gene Product Result for
Synonyms: DJ90G24.4 SAAT1 SGLT3
UniProtKB ID: Q9NY91, O15279
Gene ID:
Rat(294341) solute carrier family 5 (glucose activated ion channel), member 4
domestic cat(101100420) solute carrier family 5 (low affinity glucose cotransporter), member 4
Domestic Rabbit(100328735) solute carrier family 5 (low affinity glucose cotransporter), member 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV43940 Anti-SLC5A4 antibody produced in rabbit IgG fraction of antiserum human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014227 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014227 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014227 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU004811 MISSION® esiRNA esiRNA targeting human SLC5A4 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014227 Rosetta Predictions human pricing
NM_001106383 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014227 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00201217 predicted 693
2 SASI_Hs01_00201218 predicted 480
3 SASI_Hs01_00201219 predicted 760
4 SASI_Hs01_00201220 predicted 1367
5 SASI_Hs01_00201221 predicted 860
6 SASI_Hs01_00201222 predicted 336
7 SASI_Hs01_00201223 predicted 944
8 SASI_Hs01_00201224 predicted 381
9 SASI_Hs01_00201225 predicted 1382
10 SASI_Hs02_00345255 predicted 1253
11 SASI_Hs01_00201226 predicted 1401
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106383 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00218428 predicted 255
2 SASI_Rn02_00218429 predicted 747
3 SASI_Rn02_00218430 predicted 311
4 SASI_Rn02_00218431 predicted 1366
5 SASI_Rn02_00218432 predicted 1162
6 SASI_Rn02_00218433 predicted 777
7 SASI_Rn02_00218434 predicted 956
8 SASI_Rn02_00218435 predicted 937
9 SASI_Rn02_00218436 predicted 727
10 SASI_Rn02_00218437 predicted 558
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014227
SLC5A4 MISSION shRNA Bacterial Glycerol Stock
solute carrier family 5 (glucose activated ion channel), member 4
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000432995    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014227.2-1269s21c1
Sequence:CCGGCTGATAGCTGGACGGATATTTCTCGAGAAATATCCGTCCAGCTATCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014227.1-844s1c2
Sequence:CCGGGCCAGGAATTATATTTGGAATCTCGAGATTCCAAATATAATTCCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429259    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014227.2-1701s21c1
Sequence:CCGGACAGAGGAGCGAATCGATATACTCGAGTATATCGATTCGCTCCTCTGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424815    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014227.2-670s21c1
Sequence:CCGGTTAACGAAGTTGGAGGTTATGCTCGAGCATAACCTCCAACTTCGTTAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424752    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014227.2-375s21c1
Sequence:CCGGGTGATGACCATGCCGGAATATCTCGAGATATTCCGGCATGGTCATCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042813    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014227.1-844s1c1
Sequence:CCGGGCCAGGAATTATATTTGGAATCTCGAGATTCCAAATATAATTCCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014227.1-951s1c1
Sequence:CCGGCCGCTTGCATTATGTGTGCTTCTCGAGAAGCACACATAATGCAAGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014227.1-1340s1c1
Sequence:CCGGCCACTGGTACAAGTTTCTCAACTCGAGTTGAGAAACTTGTACCAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042815    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014227.1-309s1c1
Sequence:CCGGCCGTAACATTTGAATGGACTTCTCGAGAAGTCCATTCAAATGTTACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014227.1-92s1c1
Sequence:CCGGGCTGCTGACATCTCAGTCATTCTCGAGAATGACTGAGATGTCAGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014227
SLC5A4 MISSION shRNA shRNA Plasmid DNA
solute carrier family 5 (glucose activated ion channel), member 4
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000432995    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014227.2-1269s21c1
Sequence:CCGGCTGATAGCTGGACGGATATTTCTCGAGAAATATCCGTCCAGCTATCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014227.1-844s1c2
Sequence:CCGGGCCAGGAATTATATTTGGAATCTCGAGATTCCAAATATAATTCCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429259    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014227.2-1701s21c1
Sequence:CCGGACAGAGGAGCGAATCGATATACTCGAGTATATCGATTCGCTCCTCTGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424815    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014227.2-670s21c1
Sequence:CCGGTTAACGAAGTTGGAGGTTATGCTCGAGCATAACCTCCAACTTCGTTAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424752    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014227.2-375s21c1
Sequence:CCGGGTGATGACCATGCCGGAATATCTCGAGATATTCCGGCATGGTCATCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042813    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014227.1-844s1c1
Sequence:CCGGGCCAGGAATTATATTTGGAATCTCGAGATTCCAAATATAATTCCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014227.1-951s1c1
Sequence:CCGGCCGCTTGCATTATGTGTGCTTCTCGAGAAGCACACATAATGCAAGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014227.1-1340s1c1
Sequence:CCGGCCACTGGTACAAGTTTCTCAACTCGAGTTGAGAAACTTGTACCAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042815    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014227.1-309s1c1
Sequence:CCGGCCGTAACATTTGAATGGACTTCTCGAGAAGTCCATTCAAATGTTACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014227.1-92s1c1
Sequence:CCGGGCTGCTGACATCTCAGTCATTCTCGAGAATGACTGAGATGTCAGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014227
SLC5A4 MISSION shRNA Lentiviral Transduction Particles
solute carrier family 5 (glucose activated ion channel), member 4
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000432995    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014227.2-1269s21c1
Sequence:CCGGCTGATAGCTGGACGGATATTTCTCGAGAAATATCCGTCCAGCTATCAGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014227.1-844s1c2
Sequence:CCGGGCCAGGAATTATATTTGGAATCTCGAGATTCCAAATATAATTCCTGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429259    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014227.2-1701s21c1
Sequence:CCGGACAGAGGAGCGAATCGATATACTCGAGTATATCGATTCGCTCCTCTGTTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424815    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014227.2-670s21c1
Sequence:CCGGTTAACGAAGTTGGAGGTTATGCTCGAGCATAACCTCCAACTTCGTTAATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424752    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014227.2-375s21c1
Sequence:CCGGGTGATGACCATGCCGGAATATCTCGAGATATTCCGGCATGGTCATCACTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042813    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014227.1-844s1c1
Sequence:CCGGGCCAGGAATTATATTTGGAATCTCGAGATTCCAAATATAATTCCTGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014227.1-951s1c1
Sequence:CCGGCCGCTTGCATTATGTGTGCTTCTCGAGAAGCACACATAATGCAAGCGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014227.1-1340s1c1
Sequence:CCGGCCACTGGTACAAGTTTCTCAACTCGAGTTGAGAAACTTGTACCAGTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042815    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014227.1-309s1c1
Sequence:CCGGCCGTAACATTTGAATGGACTTCTCGAGAAGTCCATTCAAATGTTACGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014227.1-92s1c1
Sequence:CCGGGCTGCTGACATCTCAGTCATTCTCGAGAATGACTGAGATGTCAGCAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)