EMAIL THIS PAGE TO A FRIEND

SLC6A11

solute carrier family 6 (neurotransmitter transporter), member 11

46 Gene Product Result for
Synonyms: GAT-3 GAT3 GAT4
UniProtKB ID: P48066, B2R6U6
Gene ID:
Human(6538) Summary: Gamma-aminobutyric acid (GABA) is a major inhibitory neurotransmitter. GABAergic neurotransmission is terminated by the uptake of GABA into the presynaptic terminal and the surrounding astroglial cells by sodium-dependent transporters, such as SLC6A11 (Borden et al., 1994 [PubMed 7874447]
Mouse(243616) solute carrier family 6 (neurotransmitter transporter, GABA), member 11
Rat(79213) solute carrier family 6 (neurotransmitter transporter), member 11
chicken(415959) solute carrier family 6 (neurotransmitter transporter, GABA), member 11
dog(476534) solute carrier family 6 (neurotransmitter transporter, GABA), member 11
domestic cat(101092834) solute carrier family 6 (neurotransmitter transporter, GABA), member 11
domestic guinea pig(100731346) solute carrier family 6 (neurotransmitter transporter, GABA), member 11
naked mole-rat(101716874) solute carrier family 6 (neurotransmitter transporter, GABA), member 11
cow(616071) solute carrier family 6 (neurotransmitter transporter, GABA), member 11
sheep(101105536) solute carrier family 6 (neurotransmitter transporter, GABA), member 11
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014229 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014229 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014229 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172890 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172890 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172890 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU062501 MISSION® esiRNA esiRNA human SLC6A11 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014229 Rosetta Predictions human pricing
NM_024372 Rosetta Predictions rat pricing
NM_172890 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014229 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00228014 predicted 396
2 SASI_Hs01_00228015 predicted 382
3 SASI_Hs01_00228016 predicted 437
4 SASI_Hs01_00228017 predicted 456
5 SASI_Hs01_00228018 predicted 561
6 SASI_Hs01_00228019 predicted 1503
7 SASI_Hs01_00228020 predicted 1349
8 SASI_Hs01_00228021 predicted 379
9 SASI_Hs01_00228022 predicted 769
10 SASI_Hs01_00228023 predicted 1077
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024372 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00071819 predicted 1092
2 SASI_Rn02_00263959 predicted 1464
3 SASI_Rn01_00071822 predicted 1476
4 SASI_Rn01_00071823 predicted 990
5 SASI_Rn01_00071824 predicted 1170
6 SASI_Rn01_00071825 predicted 1521
7 SASI_Rn01_00071826 predicted 1606
8 SASI_Rn01_00071827 predicted 959
9 SASI_Rn02_00263960 predicted 984
10 SASI_Rn02_00263961 predicted 565
11 SASI_Rn01_00071820 predicted 1480
12 SASI_Rn01_00071821 predicted 463
13 SASI_Rn01_00071828 predicted 1073
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172890 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00118492 predicted 652
2 SASI_Mm01_00118493 predicted 1492
3 SASI_Mm01_00118494 predicted 853
4 SASI_Mm01_00118495 predicted 668
5 SASI_Mm02_00344859 predicted 1205
6 SASI_Mm01_00118496 predicted 1388
7 SASI_Mm01_00118498 predicted 1982
8 SASI_Mm02_00344860 predicted 1248
9 SASI_Mm01_00118499 predicted 1891
10 SASI_Mm01_00118500 predicted 1637
11 SASI_Mm01_00118497 predicted 755
12 SASI_Mm01_00118501 predicted 1953
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014229
SLC6A11 MISSION shRNA Bacterial Glycerol Stock
solute carrier family 6 (neurotransmitter transporter), member 11
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000042893    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014229.1-1517s1c1
Sequence:CCGGCGGTTCTATGATAACATTGAACTCGAGTTCAATGTTATCATAGAACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014229.1-742s1c1
Sequence:CCGGGACCATCTGTTACTTCTGTATCTCGAGATACAGAAGTAACAGATGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014229.1-457s1c1
Sequence:CCGGCCATCTGAATGTGTACTACATCTCGAGATGTAGTACACATTCAGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042895    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014229.1-1360s1c1
Sequence:CCGGCTTGTCTGTTATCTCCTATTTCTCGAGAAATAGGAGATAACAGACAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427917    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014229.1-576s21c1
Sequence:CCGGTGGAGTTCCAGAAACTGAATGCTCGAGCATTCAGTTTCTGGAACTCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042897    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014229.1-1774s1c1
Sequence:CCGGGCCCGAGAAACTCCAGAAGTTCTCGAGAACTTCTGGAGTTTCTCGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429186    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014229.1-985s21c1
Sequence:CCGGGACCGCTCTGGGAAGTTATAACTCGAGTTATAACTTCCCAGAGCGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416773    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014229.1-400s21c1
Sequence:CCGGGAGGAAAGTTTGCCCTTTATTCTCGAGAATAAAGGGCAAACTTTCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417630    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014229.1-794s21c1
Sequence:CCGGGTATACGTGACTGCGACATTCCTCGAGGAATGTCGCAGTCACGTATACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014229
SLC6A11 MISSION shRNA shRNA Plasmid DNA
solute carrier family 6 (neurotransmitter transporter), member 11
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000042893    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014229.1-1517s1c1
Sequence:CCGGCGGTTCTATGATAACATTGAACTCGAGTTCAATGTTATCATAGAACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014229.1-742s1c1
Sequence:CCGGGACCATCTGTTACTTCTGTATCTCGAGATACAGAAGTAACAGATGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014229.1-457s1c1
Sequence:CCGGCCATCTGAATGTGTACTACATCTCGAGATGTAGTACACATTCAGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042895    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014229.1-1360s1c1
Sequence:CCGGCTTGTCTGTTATCTCCTATTTCTCGAGAAATAGGAGATAACAGACAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427917    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014229.1-576s21c1
Sequence:CCGGTGGAGTTCCAGAAACTGAATGCTCGAGCATTCAGTTTCTGGAACTCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042897    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014229.1-1774s1c1
Sequence:CCGGGCCCGAGAAACTCCAGAAGTTCTCGAGAACTTCTGGAGTTTCTCGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429186    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014229.1-985s21c1
Sequence:CCGGGACCGCTCTGGGAAGTTATAACTCGAGTTATAACTTCCCAGAGCGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416773    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014229.1-400s21c1
Sequence:CCGGGAGGAAAGTTTGCCCTTTATTCTCGAGAATAAAGGGCAAACTTTCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417630    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014229.1-794s21c1
Sequence:CCGGGTATACGTGACTGCGACATTCCTCGAGGAATGTCGCAGTCACGTATACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014229
SLC6A11 MISSION shRNA Lentiviral Transduction Particles
solute carrier family 6 (neurotransmitter transporter), member 11
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000042893    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014229.1-1517s1c1
Sequence:CCGGCGGTTCTATGATAACATTGAACTCGAGTTCAATGTTATCATAGAACCGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000042896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014229.1-742s1c1
Sequence:CCGGGACCATCTGTTACTTCTGTATCTCGAGATACAGAAGTAACAGATGGTCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000042894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014229.1-457s1c1
Sequence:CCGGCCATCTGAATGTGTACTACATCTCGAGATGTAGTACACATTCAGATGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000042895    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014229.1-1360s1c1
Sequence:CCGGCTTGTCTGTTATCTCCTATTTCTCGAGAAATAGGAGATAACAGACAAGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000427917    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014229.1-576s21c1
Sequence:CCGGTGGAGTTCCAGAAACTGAATGCTCGAGCATTCAGTTTCTGGAACTCCATTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000042897    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014229.1-1774s1c1
Sequence:CCGGGCCCGAGAAACTCCAGAAGTTCTCGAGAACTTCTGGAGTTTCTCGGGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000429186    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014229.1-985s21c1
Sequence:CCGGGACCGCTCTGGGAAGTTATAACTCGAGTTATAACTTCCCAGAGCGGTCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000416773    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014229.1-400s21c1
Sequence:CCGGGAGGAAAGTTTGCCCTTTATTCTCGAGAATAAAGGGCAAACTTTCCTCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000417630    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014229.1-794s21c1
Sequence:CCGGGTATACGTGACTGCGACATTCCTCGAGGAATGTCGCAGTCACGTATACTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172890
SLC6A11 MISSION shRNA Bacterial Glycerol Stock
solute carrier family 6 (neurotransmitter transporter), member 11
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000079538    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172890.1-2877s1c1
Sequence:CCGGCCAGGATCTATGGCTTAGGATCTCGAGATCCTAAGCCATAGATCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000079539    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172890.1-1762s1c1
Sequence:CCGGGCCCGAGAAATTACAGAAGTTCTCGAGAACTTCTGTAATTTCTCGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000079542    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172890.1-397s1c1
Sequence:CCGGCTGCCCTTTATTTGAAGGCATCTCGAGATGCCTTCAAATAAAGGGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000079541    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172890.1-1285s1c1
Sequence:CCGGCGTGGTAGACATGTACCCTAACTCGAGTTAGGGTACATGTCTACCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000079540    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172890.1-655s1c1
Sequence:CCGGCTTGGCTATATCCGATGGCATCTCGAGATGCCATCGGATATAGCCAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172890
SLC6A11 MISSION shRNA shRNA Plasmid DNA
solute carrier family 6 (neurotransmitter transporter), member 11
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000079538    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172890.1-2877s1c1
Sequence:CCGGCCAGGATCTATGGCTTAGGATCTCGAGATCCTAAGCCATAGATCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000079539    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172890.1-1762s1c1
Sequence:CCGGGCCCGAGAAATTACAGAAGTTCTCGAGAACTTCTGTAATTTCTCGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000079542    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172890.1-397s1c1
Sequence:CCGGCTGCCCTTTATTTGAAGGCATCTCGAGATGCCTTCAAATAAAGGGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000079541    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172890.1-1285s1c1
Sequence:CCGGCGTGGTAGACATGTACCCTAACTCGAGTTAGGGTACATGTCTACCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000079540    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172890.1-655s1c1
Sequence:CCGGCTTGGCTATATCCGATGGCATCTCGAGATGCCATCGGATATAGCCAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172890
SLC6A11 MISSION shRNA Lentiviral Transduction Particles
solute carrier family 6 (neurotransmitter transporter), member 11
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000079538    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172890.1-2877s1c1
Sequence:CCGGCCAGGATCTATGGCTTAGGATCTCGAGATCCTAAGCCATAGATCCTGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000079539    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172890.1-1762s1c1
Sequence:CCGGGCCCGAGAAATTACAGAAGTTCTCGAGAACTTCTGTAATTTCTCGGGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000079542    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172890.1-397s1c1
Sequence:CCGGCTGCCCTTTATTTGAAGGCATCTCGAGATGCCTTCAAATAAAGGGCAGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000079541    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172890.1-1285s1c1
Sequence:CCGGCGTGGTAGACATGTACCCTAACTCGAGTTAGGGTACATGTCTACCACGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000079540    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172890.1-655s1c1
Sequence:CCGGCTTGGCTATATCCGATGGCATCTCGAGATGCCATCGGATATAGCCAAGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???