EMAIL THIS PAGE TO A FRIEND

SLC6A12

solute carrier family 6 (neurotransmitter transporter), member 12

65 Gene Product Result for
Synonyms: BGT-1 BGT1 GAT2
UniProtKB ID: P48065, A0AV52, B2R992, D3DUN8
Gene ID:
Mouse(14411) solute carrier family 6 (neurotransmitter transporter, betaine/GABA), member 12
Rat(50676) solute carrier family 6 (neurotransmitter transporter), member 12
domestic cat(101088338) solute carrier family 6 (neurotransmitter transporter, betaine/GABA), member 12
dog(404013) solute carrier family 6 (neurotransmitter transporter, betaine/GABA), member 12
cow(514339) solute carrier family 6 (neurotransmitter transporter, betaine/GABA), member 12
sheep(101114770) solute carrier family 6 (neurotransmitter transporter, betaine/GABA), member 12
naked mole-rat(101725721) solute carrier family 6 (neurotransmitter transporter, betaine/GABA), member 12
Domestic Rabbit(100009202) solute carrier family 6 (neurotransmitter transporter, betaine/GABA), member 12
domestic guinea pig(100731511) solute carrier family 6 (neurotransmitter transporter, betaine/GABA), member 12
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003044 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003044 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003044 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_133661 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133661 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133661 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU085891 MISSION® esiRNA esiRNA human SLC6A12 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001122847 Rosetta Predictions human pricing
NM_001122848 Rosetta Predictions human pricing
NM_003044 Rosetta Predictions human pricing
NM_017335 Rosetta Predictions rat pricing
NM_133661 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001122847 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00327497 predicted 1730
2 SASI_Hs02_00327498 predicted 1643
3 SASI_Hs02_00327499 predicted 1484
4 SASI_Hs02_00327500 predicted 863
5 SASI_Hs02_00327501 predicted 1834
6 SASI_Hs02_00327502 predicted 789
7 SASI_Hs02_00327503 predicted 1116
8 SASI_Hs02_00327504 predicted 672
9 SASI_Hs02_00327505 predicted 1810
10 SASI_Hs02_00327506 predicted 2135
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001122848 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00327507 predicted 1864
2 SASI_Hs02_00327508 predicted 1773
3 SASI_Hs02_00327509 predicted 1611
4 SASI_Hs02_00327510 predicted 987
5 SASI_Hs02_00327511 predicted 1962
6 SASI_Hs02_00327512 predicted 917
7 SASI_Hs02_00327513 predicted 1242
8 SASI_Hs02_00327514 predicted 801
9 SASI_Hs02_00327515 predicted 1945
10 SASI_Hs02_00327516 predicted 2261
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003044 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00213849 predicted 1972
2 SASI_Hs01_00213850 predicted 1881
3 SASI_Hs01_00213852 predicted 1728
4 SASI_Hs01_00213853 predicted 1101
5 SASI_Hs01_00213854 predicted 2074
6 SASI_Hs01_00213855 predicted 1026
7 SASI_Hs01_00213856 predicted 1354
8 SASI_Hs01_00213857 predicted 919
9 SASI_Hs01_00213851 predicted 2054
10 SASI_Hs02_00334956 predicted 2372
11 SASI_Hs01_00213848 predicted 2449
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017335 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00060812 predicted 1896
2 SASI_Rn01_00060814 predicted 719
3 SASI_Rn01_00060815 predicted 1157
4 SASI_Rn01_00060816 predicted 1627
5 SASI_Rn01_00060817 predicted 1902
6 SASI_Rn01_00060818 predicted 1826
7 SASI_Rn01_00060819 predicted 1458
8 SASI_Rn01_00060820 predicted 872
9 SASI_Rn01_00060821 predicted 1782
10 SASI_Rn02_00261792 predicted 1686
11 SASI_Rn01_00060813 predicted 1871
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133661 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00173156 predicted 1357
2 SASI_Mm01_00173157 predicted 1864
3 SASI_Mm01_00173158 predicted 1747
4 SASI_Mm01_00173159 predicted 692
5 SASI_Mm01_00173160 predicted 1646
6 SASI_Mm01_00173161 predicted 290
7 SASI_Mm01_00173162 predicted 1132
8 SASI_Mm02_00338591 predicted 1367
9 SASI_Mm01_00173163 predicted 1873
10 SASI_Mm01_00173164 predicted 319
11 SASI_Mm01_00173165 predicted 343
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003044
SLC6A12 MISSION shRNA Bacterial Glycerol Stock
solute carrier family 6 (neurotransmitter transporter), member 12
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000437538    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003044.3-2847s21c1
Sequence:CCGGGTTGGATCGGAGGTTCCGTTACTCGAGTAACGGAACCTCCGATCCAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426858    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003044.3-1113s21c1
Sequence:CCGGATTCTGGGAGAGACGAGTTCTCTCGAGAGAACTCGTCTCTCCCAGAATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003044.2-1994s1c1
Sequence:CCGGGTCTGCATAAGCTGGGTGTATCTCGAGATACACCCAGCTTATGCAGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038297    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003044.2-1402s1c1
Sequence:CCGGGCCAGATTTGTTCCGCCTCAACTCGAGTTGAGGCGGAACAAATCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038294    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003044.2-961s1c1
Sequence:CCGGCGAGTCATATTTGAATGTCTACTCGAGTAGACATTCAAATATGACTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038295    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003044.2-1322s1c1
Sequence:CCGGCCGTACCTGATGCTTGTCATTCTCGAGAATGACAAGCATCAGGTACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038298    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003044.2-1870s1c1
Sequence:CCGGCGCCGTCATGTGCTACCTGATCTCGAGATCAGGTAGCACATGACGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003044
SLC6A12 MISSION shRNA shRNA Plasmid DNA
solute carrier family 6 (neurotransmitter transporter), member 12
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000437538    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003044.3-2847s21c1
Sequence:CCGGGTTGGATCGGAGGTTCCGTTACTCGAGTAACGGAACCTCCGATCCAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426858    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003044.3-1113s21c1
Sequence:CCGGATTCTGGGAGAGACGAGTTCTCTCGAGAGAACTCGTCTCTCCCAGAATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000038296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003044.2-1994s1c1
Sequence:CCGGGTCTGCATAAGCTGGGTGTATCTCGAGATACACCCAGCTTATGCAGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000038297    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003044.2-1402s1c1
Sequence:CCGGGCCAGATTTGTTCCGCCTCAACTCGAGTTGAGGCGGAACAAATCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000038294    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003044.2-961s1c1
Sequence:CCGGCGAGTCATATTTGAATGTCTACTCGAGTAGACATTCAAATATGACTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000038295    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003044.2-1322s1c1
Sequence:CCGGCCGTACCTGATGCTTGTCATTCTCGAGAATGACAAGCATCAGGTACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000038298    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003044.2-1870s1c1
Sequence:CCGGCGCCGTCATGTGCTACCTGATCTCGAGATCAGGTAGCACATGACGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003044
SLC6A12 MISSION shRNA Lentiviral Transduction Particles
solute carrier family 6 (neurotransmitter transporter), member 12
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000437538    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003044.3-2847s21c1
Sequence:CCGGGTTGGATCGGAGGTTCCGTTACTCGAGTAACGGAACCTCCGATCCAACTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000426858    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003044.3-1113s21c1
Sequence:CCGGATTCTGGGAGAGACGAGTTCTCTCGAGAGAACTCGTCTCTCCCAGAATTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000038296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003044.2-1994s1c1
Sequence:CCGGGTCTGCATAAGCTGGGTGTATCTCGAGATACACCCAGCTTATGCAGACTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000038297    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003044.2-1402s1c1
Sequence:CCGGGCCAGATTTGTTCCGCCTCAACTCGAGTTGAGGCGGAACAAATCTGGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000038294    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003044.2-961s1c1
Sequence:CCGGCGAGTCATATTTGAATGTCTACTCGAGTAGACATTCAAATATGACTCGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000038295    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003044.2-1322s1c1
Sequence:CCGGCCGTACCTGATGCTTGTCATTCTCGAGAATGACAAGCATCAGGTACGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000038298    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003044.2-1870s1c1
Sequence:CCGGCGCCGTCATGTGCTACCTGATCTCGAGATCAGGTAGCACATGACGGCGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133661
SLC6A12 MISSION shRNA Bacterial Glycerol Stock
solute carrier family 6 (neurotransmitter transporter), member 12
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000070238    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133661.1-2119s1c1
Sequence:CCGGCCAGCCAAACAAGAACTCATTCTCGAGAATGAGTTCTTGTTTGGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070242    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133661.1-1874s1c1
Sequence:CCGGGCAAGTATACACCTCTCAAATCTCGAGATTTGAGAGGTGTATACTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133661.1-1759s1c1
Sequence:CCGGCGTTTCTATGACAACGTGGAACTCGAGTTCCACGTTGTCATAGAAACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070239    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133661.1-1057s1c1
Sequence:CCGGCCCTACCTGATGCTGATTATTCTCGAGAATAATCAGCATCAGGTAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133661.1-696s1c1
Sequence:CCGGCGAGTCTTATTTGAACATCTACTCGAGTAGATGTTCAAATAAGACTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133661
SLC6A12 MISSION shRNA shRNA Plasmid DNA
solute carrier family 6 (neurotransmitter transporter), member 12
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000070238    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133661.1-2119s1c1
Sequence:CCGGCCAGCCAAACAAGAACTCATTCTCGAGAATGAGTTCTTGTTTGGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070242    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133661.1-1874s1c1
Sequence:CCGGGCAAGTATACACCTCTCAAATCTCGAGATTTGAGAGGTGTATACTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133661.1-1759s1c1
Sequence:CCGGCGTTTCTATGACAACGTGGAACTCGAGTTCCACGTTGTCATAGAAACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070239    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133661.1-1057s1c1
Sequence:CCGGCCCTACCTGATGCTGATTATTCTCGAGAATAATCAGCATCAGGTAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133661.1-696s1c1
Sequence:CCGGCGAGTCTTATTTGAACATCTACTCGAGTAGATGTTCAAATAAGACTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133661
SLC6A12 MISSION shRNA Lentiviral Transduction Particles
solute carrier family 6 (neurotransmitter transporter), member 12
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000070238    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133661.1-2119s1c1
Sequence:CCGGCCAGCCAAACAAGAACTCATTCTCGAGAATGAGTTCTTGTTTGGCTGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000070242    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133661.1-1874s1c1
Sequence:CCGGGCAAGTATACACCTCTCAAATCTCGAGATTTGAGAGGTGTATACTTGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000070240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133661.1-1759s1c1
Sequence:CCGGCGTTTCTATGACAACGTGGAACTCGAGTTCCACGTTGTCATAGAAACGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000070239    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133661.1-1057s1c1
Sequence:CCGGCCCTACCTGATGCTGATTATTCTCGAGAATAATCAGCATCAGGTAGGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000070241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133661.1-696s1c1
Sequence:CCGGCGAGTCTTATTTGAACATCTACTCGAGTAGATGTTCAAATAAGACTCGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???