EMAIL THIS PAGE TO A FRIEND

SLC6A13

solute carrier family 6 (neurotransmitter transporter), member 13

54 Gene Product Result for
Synonyms: GAT-2 GAT2 GAT3
UniProtKB ID: Q9NSD5, B4DJL1, Q8TCC2, Q8WW56
Gene ID:
Mouse(14412) solute carrier family 6 (neurotransmitter transporter, GABA), member 13
Rat(171163) solute carrier family 6 (neurotransmitter transporter), member 13
domestic guinea pig(100731237) solute carrier family 6 (neurotransmitter transporter, GABA), member 13
Domestic Rabbit(100352075) solute carrier family 6 (neurotransmitter transporter, GABA), member 13
naked mole-rat(101697408) solute carrier family 6 (neurotransmitter transporter, GABA), member 13
cow(523784) solute carrier family 6 (neurotransmitter transporter, GABA), member 13
sheep(101119630) solute carrier family 6 (neurotransmitter transporter, GABA), member 13
Zebrafish(368923) solute carrier family 6 (neurotransmitter transporter, GABA), member 13
Horse(100050539) solute carrier family 6 (neurotransmitter transporter, GABA), member 13
domestic cat(101088087) solute carrier family 6 (neurotransmitter transporter, GABA), member 13
dog(100683632) solute carrier family 6 (neurotransmitter transporter, GABA), member 13
chicken(418147) solute carrier family 6 (neurotransmitter transporter, GABA), member 13
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_144512 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_144512 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_144512 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_016615 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016615 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016615 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016615 Rosetta Predictions human pricing
NM_133623 Rosetta Predictions rat pricing
NM_144512 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016615 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00216673 predicted 1363
2 SASI_Hs01_00216674 predicted 1475
3 SASI_Hs01_00216675 predicted 560
4 SASI_Hs01_00216676 predicted 1316
5 SASI_Hs01_00216677 predicted 531
6 SASI_Hs01_00216678 predicted 1483
7 SASI_Hs01_00216679 predicted 753
8 SASI_Hs01_00216680 predicted 1577
9 SASI_Hs01_00216681 predicted 1470
10 SASI_Hs01_00216682 predicted 1729
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133623 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00088548 predicted 863
2 SASI_Rn01_00088549 predicted 623
3 SASI_Rn01_00088550 predicted 493
4 SASI_Rn01_00088551 predicted 1586
5 SASI_Rn02_00267851 predicted 1593
6 SASI_Rn01_00088552 predicted 1641
7 SASI_Rn01_00088553 predicted 636
8 SASI_Rn01_00088554 predicted 1572
9 SASI_Rn01_00088556 predicted 697
10 SASI_Rn01_00088557 predicted 1551
11 SASI_Rn01_00088555 predicted 539
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144512 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00040562 predicted 412
2 SASI_Mm01_00040563 predicted 544
3 SASI_Mm01_00040564 predicted 1346
4 SASI_Mm01_00040565 predicted 351
5 SASI_Mm01_00040566 predicted 1505
6 SASI_Mm01_00040567 predicted 1554
7 SASI_Mm01_00040568 predicted 1512
8 SASI_Mm01_00040569 predicted 1472
9 SASI_Mm01_00040570 predicted 452
10 SASI_Mm01_00040571 predicted 1401
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144512
VALIDATED
SLC6A13 MISSION shRNA Bacterial Glycerol Stock
solute carrier family 6 (neurotransmitter transporter), member 13
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000079832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144512.1-1293s1c1
Sequence:CCGGCCTCATCCTTATTGTGTCCGTCTCGAGACGGACACAATAAGGATGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332084    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144512.2-2032s21c1
Sequence:CCGGCCGAATCAATAACATCCCATTCTCGAGAATGGGATGTTATTGATTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311347    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144512.2-1460s21c1
Sequence:CCGGGCCGCTTCTACGACAACATTGCTCGAGCAATGTTGTCGTAGAAGCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311348    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144512.2-1500s21c1
Sequence:CCGGGCCATGGCCTCTTATCAAATACTCGAGTATTTGATAAGAGGCCATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305470    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144512.2-531s21c1
Sequence:CCGGATTCCAGAAGGCCAATGATTCCTCGAGGAATCATTGGCCTTCTGGAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000079828    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144512.1-2032s1c1
Sequence:CCGGCCGAATCAATAACATCCCATTCTCGAGAATGGGATGTTATTGATTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000079829    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144512.1-1075s1c1
Sequence:CCGGCCCATATCTGAGGTTGCTGAACTCGAGTTCAGCAACCTCAGATATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000079830    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144512.1-1208s1c1
Sequence:CCGGGCCAGTTTGTGTGTGTAGAAACTCGAGTTTCTACACACACAAACTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000079831    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144512.1-1587s1c1
Sequence:CCGGGCCACTGACCTACAACAAGAACTCGAGTTCTTGTTGTAGGTCAGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305469    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144512.2-1562s21c1
Sequence:CCGGTCCTGTTCTCCCTGATCAAATCTCGAGATTTGATCAGGGAGAACAGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144512
VALIDATED
SLC6A13 MISSION shRNA shRNA Plasmid DNA
solute carrier family 6 (neurotransmitter transporter), member 13
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000079832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144512.1-1293s1c1
Sequence:CCGGCCTCATCCTTATTGTGTCCGTCTCGAGACGGACACAATAAGGATGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000332084    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144512.2-2032s21c1
Sequence:CCGGCCGAATCAATAACATCCCATTCTCGAGAATGGGATGTTATTGATTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000311347    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144512.2-1460s21c1
Sequence:CCGGGCCGCTTCTACGACAACATTGCTCGAGCAATGTTGTCGTAGAAGCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000311348    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144512.2-1500s21c1
Sequence:CCGGGCCATGGCCTCTTATCAAATACTCGAGTATTTGATAAGAGGCCATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000305470    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144512.2-531s21c1
Sequence:CCGGATTCCAGAAGGCCAATGATTCCTCGAGGAATCATTGGCCTTCTGGAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000079828    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144512.1-2032s1c1
Sequence:CCGGCCGAATCAATAACATCCCATTCTCGAGAATGGGATGTTATTGATTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000079829    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144512.1-1075s1c1
Sequence:CCGGCCCATATCTGAGGTTGCTGAACTCGAGTTCAGCAACCTCAGATATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000079830    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144512.1-1208s1c1
Sequence:CCGGGCCAGTTTGTGTGTGTAGAAACTCGAGTTTCTACACACACAAACTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000079831    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144512.1-1587s1c1
Sequence:CCGGGCCACTGACCTACAACAAGAACTCGAGTTCTTGTTGTAGGTCAGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000305469    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144512.2-1562s21c1
Sequence:CCGGTCCTGTTCTCCCTGATCAAATCTCGAGATTTGATCAGGGAGAACAGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144512
VALIDATED
SLC6A13 MISSION shRNA Lentiviral Transduction Particles
solute carrier family 6 (neurotransmitter transporter), member 13
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000079832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144512.1-1293s1c1
Sequence:CCGGCCTCATCCTTATTGTGTCCGTCTCGAGACGGACACAATAAGGATGAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000332084    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144512.2-2032s21c1
Sequence:CCGGCCGAATCAATAACATCCCATTCTCGAGAATGGGATGTTATTGATTCGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000311347    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144512.2-1460s21c1
Sequence:CCGGGCCGCTTCTACGACAACATTGCTCGAGCAATGTTGTCGTAGAAGCGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000311348    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144512.2-1500s21c1
Sequence:CCGGGCCATGGCCTCTTATCAAATACTCGAGTATTTGATAAGAGGCCATGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000305470    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144512.2-531s21c1
Sequence:CCGGATTCCAGAAGGCCAATGATTCCTCGAGGAATCATTGGCCTTCTGGAATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000079828    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144512.1-2032s1c1
Sequence:CCGGCCGAATCAATAACATCCCATTCTCGAGAATGGGATGTTATTGATTCGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000079829    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144512.1-1075s1c1
Sequence:CCGGCCCATATCTGAGGTTGCTGAACTCGAGTTCAGCAACCTCAGATATGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000079830    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144512.1-1208s1c1
Sequence:CCGGGCCAGTTTGTGTGTGTAGAAACTCGAGTTTCTACACACACAAACTGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000079831    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144512.1-1587s1c1
Sequence:CCGGGCCACTGACCTACAACAAGAACTCGAGTTCTTGTTGTAGGTCAGTGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000305469    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144512.2-1562s21c1
Sequence:CCGGTCCTGTTCTCCCTGATCAAATCTCGAGATTTGATCAGGGAGAACAGGATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016615
SLC6A13 MISSION shRNA Bacterial Glycerol Stock
solute carrier family 6 (neurotransmitter transporter), member 13
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000042913    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016615.2-431s1c1
Sequence:CCGGCGTCTACTACATCATTGTGTTCTCGAGAACACAATGATGTAGTAGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016615.2-99s1c1
Sequence:CCGGCCAGTGTATCCAGTCATGGAACTCGAGTTCCATGACTGGATACACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016615.2-621s1c1
Sequence:CCGGCGGGTCTTGAAGATCTCTGATCTCGAGATCAGAGATCTTCAAGACCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016615.2-1476s1c1
Sequence:CCGGCGCTTCTACGACAACATCGAACTCGAGTTCGATGTTGTCGTAGAAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423193    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016615.2-272s21c1
Sequence:CCGGCTACCTCGTCTTCCTCTTTACCTCGAGGTAAAGAGGAAGACGAGGTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414936    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016615.2-1306s21c1
Sequence:CCGGTCCTCATCCTTGGAGTATCTGCTCGAGCAGATACTCCAAGGATGAGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016615
SLC6A13 MISSION shRNA shRNA Plasmid DNA
solute carrier family 6 (neurotransmitter transporter), member 13
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000042913    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016615.2-431s1c1
Sequence:CCGGCGTCTACTACATCATTGTGTTCTCGAGAACACAATGATGTAGTAGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016615.2-99s1c1
Sequence:CCGGCCAGTGTATCCAGTCATGGAACTCGAGTTCCATGACTGGATACACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016615.2-621s1c1
Sequence:CCGGCGGGTCTTGAAGATCTCTGATCTCGAGATCAGAGATCTTCAAGACCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016615.2-1476s1c1
Sequence:CCGGCGCTTCTACGACAACATCGAACTCGAGTTCGATGTTGTCGTAGAAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423193    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016615.2-272s21c1
Sequence:CCGGCTACCTCGTCTTCCTCTTTACCTCGAGGTAAAGAGGAAGACGAGGTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414936    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016615.2-1306s21c1
Sequence:CCGGTCCTCATCCTTGGAGTATCTGCTCGAGCAGATACTCCAAGGATGAGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016615
SLC6A13 MISSION shRNA Lentiviral Transduction Particles
solute carrier family 6 (neurotransmitter transporter), member 13
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000042913    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016615.2-431s1c1
Sequence:CCGGCGTCTACTACATCATTGTGTTCTCGAGAACACAATGATGTAGTAGACGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016615.2-99s1c1
Sequence:CCGGCCAGTGTATCCAGTCATGGAACTCGAGTTCCATGACTGGATACACTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016615.2-621s1c1
Sequence:CCGGCGGGTCTTGAAGATCTCTGATCTCGAGATCAGAGATCTTCAAGACCCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016615.2-1476s1c1
Sequence:CCGGCGCTTCTACGACAACATCGAACTCGAGTTCGATGTTGTCGTAGAAGCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423193    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016615.2-272s21c1
Sequence:CCGGCTACCTCGTCTTCCTCTTTACCTCGAGGTAAAGAGGAAGACGAGGTAGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414936    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016615.2-1306s21c1
Sequence:CCGGTCCTCATCCTTGGAGTATCTGCTCGAGCAGATACTCCAAGGATGAGGATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)