EMAIL THIS PAGE TO A FRIEND

SLC6A14

solute carrier family 6 (amino acid transporter), member 14

133 Gene Product Result for
Synonyms: BMIQ11
UniProtKB ID: Q9UN76, Q5H942
Gene ID:
Human(11254) Summary: This gene encodes a member of the solute carrier family 6. Members of this family are sodium and chloride dependent neurotransmitter transporters. The encoded protein transports both neutral and cationic amino acids. This protein may also function as a beta-alanine carrier. Mutations in this gene may be associated with X-linked obesity. A pseudogene of this gene is found on chromosome X.[provided by RefSeq, May 2010]
Mouse(56774) solute carrier family 6 (neurotransmitter transporter), member 14
Rat(298340) solute carrier family 6 (amino acid transporter), member 14
Zebrafish(100150665) solute carrier family 6 (amino acid transporter), member 14
chicken(100857521) solute carrier family 6 (amino acid transporter), member 14
domestic cat(101080769) solute carrier family 6 (amino acid transporter), member 14
Horse(100053824) solute carrier family 6 (amino acid transporter), member 14
dog(492085) solute carrier family 6 (amino acid transporter), member 14
cow(511661) solute carrier family 6 (amino acid transporter), member 14
sheep(101107169) solute carrier family 6 (amino acid transporter), member 14
naked mole-rat(101719394) solute carrier family 6 (amino acid transporter), member 14
Domestic Rabbit(100348180) solute carrier family 6 (amino acid transporter), member 14
domestic guinea pig(100730539) solute carrier family 6 (amino acid transporter), member 14
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007231 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007231 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007231 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_020049 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_020049 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_020049 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU030211 MISSION® esiRNA esiRNA targeting mouse Slc6a14 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_007231 Rosetta Predictions human pricing
NM_001037544 Rosetta Predictions rat pricing
NM_020049 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007231 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00024290 predicted 1775
2 SASI_Hs01_00024291 predicted 327
3 SASI_Hs01_00024293 predicted 307
4 SASI_Hs01_00024294 predicted 581
5 SASI_Hs01_00024295 predicted 476
6 SASI_Hs01_00024296 predicted 405
7 SASI_Hs01_00024297 predicted 842
8 SASI_Hs01_00024299 predicted 692
9 SASI_Hs02_00343235 predicted 1669
10 SASI_Hs02_00343236 predicted 680
11 SASI_Hs01_00024292 predicted 1584
12 SASI_Hs01_00024298 predicted 448
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037544 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00063825 predicted 1179
2 SASI_Rn01_00063826 predicted 921
3 SASI_Rn01_00063827 predicted 1514
4 SASI_Rn01_00063828 predicted 1876
5 SASI_Rn01_00063829 predicted 1750
6 SASI_Rn02_00204483 predicted 735
7 SASI_Rn01_00063831 predicted 865
8 SASI_Rn01_00063832 predicted 1586
9 SASI_Rn01_00063834 predicted 1319
10 SASI_Rn02_00204484 predicted 801
11 SASI_Rn01_00063830 predicted 577
12 SASI_Rn01_00063833 predicted 1287
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020049 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00040061 predicted 1580
2 SASI_Mm01_00040062 predicted 935
3 SASI_Mm01_00040064 predicted 1941
4 SASI_Mm02_00325412 predicted 866
5 SASI_Mm01_00040065 predicted 1836
6 SASI_Mm01_00040066 predicted 990
7 SASI_Mm01_00040068 predicted 1385
8 SASI_Mm01_00040069 predicted 1798
9 SASI_Mm01_00040070 predicted 1227
10 SASI_Mm02_00325413 predicted 1512
11 SASI_Mm01_00040063 predicted 1458
12 SASI_Mm01_00040067 predicted 702
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007231
SLC6A14 MISSION shRNA Bacterial Glycerol Stock
solute carrier family 6 (amino acid transporter), member 14
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000423734    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007231.2-850s21c1
Sequence:CCGGTAGTTGGAGCAGCACTATTTACTCGAGTAAATAGTGCTGCTCCAACTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418242    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007231.2-506s21c1
Sequence:CCGGCATAATTGCCTATAGTCTTTACTCGAGTAAAGACTATAGGCAATTATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421162    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007231.2-882s21c1
Sequence:CCGGTCGTCTGGCAAGGTGGTATATCTCGAGATATACCACCTTGCCAGACGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038299    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007231.1-1553s1c1
Sequence:CCGGGCAGCTATACTGGAGCTAGTTCTCGAGAACTAGCTCCAGTATAGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038302    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007231.1-1857s1c1
Sequence:CCGGGAAACATCTTTCAACGCCTTACTCGAGTAAGGCGTTGAAAGATGTTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038300    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007231.1-306s1c1
Sequence:CCGGCCTTCTTGATACCTTATGCAACTCGAGTTGCATAAGGTATCAAGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038303    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007231.1-142s1c1
Sequence:CCGGGTCGGCTTCATCAGAGAATTTCTCGAGAAATTCTCTGATGAAGCCGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007231.1-726s1c1
Sequence:CCGGCCAGTGAACAATATTGGAATACTCGAGTATTCCAATATTGTTCACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429309    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007231.2-1742s21c1
Sequence:CCGGGCAATTTCATAGACCTAATTACTCGAGTAATTAGGTCTATGAAATTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007231
SLC6A14 MISSION shRNA shRNA Plasmid DNA
solute carrier family 6 (amino acid transporter), member 14
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000423734    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007231.2-850s21c1
Sequence:CCGGTAGTTGGAGCAGCACTATTTACTCGAGTAAATAGTGCTGCTCCAACTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418242    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007231.2-506s21c1
Sequence:CCGGCATAATTGCCTATAGTCTTTACTCGAGTAAAGACTATAGGCAATTATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421162    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007231.2-882s21c1
Sequence:CCGGTCGTCTGGCAAGGTGGTATATCTCGAGATATACCACCTTGCCAGACGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000038299    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007231.1-1553s1c1
Sequence:CCGGGCAGCTATACTGGAGCTAGTTCTCGAGAACTAGCTCCAGTATAGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000038302    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007231.1-1857s1c1
Sequence:CCGGGAAACATCTTTCAACGCCTTACTCGAGTAAGGCGTTGAAAGATGTTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000038300    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007231.1-306s1c1
Sequence:CCGGCCTTCTTGATACCTTATGCAACTCGAGTTGCATAAGGTATCAAGAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000038303    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007231.1-142s1c1
Sequence:CCGGGTCGGCTTCATCAGAGAATTTCTCGAGAAATTCTCTGATGAAGCCGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000038301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007231.1-726s1c1
Sequence:CCGGCCAGTGAACAATATTGGAATACTCGAGTATTCCAATATTGTTCACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429309    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007231.2-1742s21c1
Sequence:CCGGGCAATTTCATAGACCTAATTACTCGAGTAATTAGGTCTATGAAATTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007231
SLC6A14 MISSION shRNA Lentiviral Transduction Particles
solute carrier family 6 (amino acid transporter), member 14
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000423734    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007231.2-850s21c1
Sequence:CCGGTAGTTGGAGCAGCACTATTTACTCGAGTAAATAGTGCTGCTCCAACTATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418242    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007231.2-506s21c1
Sequence:CCGGCATAATTGCCTATAGTCTTTACTCGAGTAAAGACTATAGGCAATTATGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421162    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007231.2-882s21c1
Sequence:CCGGTCGTCTGGCAAGGTGGTATATCTCGAGATATACCACCTTGCCAGACGATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000038299    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007231.1-1553s1c1
Sequence:CCGGGCAGCTATACTGGAGCTAGTTCTCGAGAACTAGCTCCAGTATAGCTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000038302    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007231.1-1857s1c1
Sequence:CCGGGAAACATCTTTCAACGCCTTACTCGAGTAAGGCGTTGAAAGATGTTTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000038300    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007231.1-306s1c1
Sequence:CCGGCCTTCTTGATACCTTATGCAACTCGAGTTGCATAAGGTATCAAGAAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000038303    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007231.1-142s1c1
Sequence:CCGGGTCGGCTTCATCAGAGAATTTCTCGAGAAATTCTCTGATGAAGCCGACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000038301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007231.1-726s1c1
Sequence:CCGGCCAGTGAACAATATTGGAATACTCGAGTATTCCAATATTGTTCACTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429309    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007231.2-1742s21c1
Sequence:CCGGGCAATTTCATAGACCTAATTACTCGAGTAATTAGGTCTATGAAATTGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020049
SLC6A14 MISSION shRNA Bacterial Glycerol Stock
solute carrier family 6 (amino acid transporter), member 14
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000079679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020049.2-1585s1c1
Sequence:CCGGGCTGGAATTTACTGGGTTCATCTCGAGATGAACCCAGTAAATTCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000079682    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020049.2-1896s1c1
Sequence:CCGGCTGCATTATTTGGATACCAATCTCGAGATTGGTATCCAAATAATGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000079678    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020049.2-2811s1c1
Sequence:CCGGCCAAAGAAGTTCCACAAATATCTCGAGATATTTGTGGAACTTCTTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000079681    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020049.2-1586s1c1
Sequence:CCGGCTGGAATTTACTGGGTTCATTCTCGAGAATGAACCCAGTAAATTCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000079680    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020049.2-818s1c1
Sequence:CCGGCCAGTGAACAGTATTGGGATACTCGAGTATCCCAATACTGTTCACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020049
SLC6A14 MISSION shRNA shRNA Plasmid DNA
solute carrier family 6 (amino acid transporter), member 14
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000079679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020049.2-1585s1c1
Sequence:CCGGGCTGGAATTTACTGGGTTCATCTCGAGATGAACCCAGTAAATTCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000079682    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020049.2-1896s1c1
Sequence:CCGGCTGCATTATTTGGATACCAATCTCGAGATTGGTATCCAAATAATGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000079678    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020049.2-2811s1c1
Sequence:CCGGCCAAAGAAGTTCCACAAATATCTCGAGATATTTGTGGAACTTCTTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000079681    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020049.2-1586s1c1
Sequence:CCGGCTGGAATTTACTGGGTTCATTCTCGAGAATGAACCCAGTAAATTCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000079680    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020049.2-818s1c1
Sequence:CCGGCCAGTGAACAGTATTGGGATACTCGAGTATCCCAATACTGTTCACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020049
SLC6A14 MISSION shRNA Lentiviral Transduction Particles
solute carrier family 6 (amino acid transporter), member 14
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000079679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020049.2-1585s1c1
Sequence:CCGGGCTGGAATTTACTGGGTTCATCTCGAGATGAACCCAGTAAATTCCAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000079682    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020049.2-1896s1c1
Sequence:CCGGCTGCATTATTTGGATACCAATCTCGAGATTGGTATCCAAATAATGCAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000079678    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020049.2-2811s1c1
Sequence:CCGGCCAAAGAAGTTCCACAAATATCTCGAGATATTTGTGGAACTTCTTTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000079681    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020049.2-1586s1c1
Sequence:CCGGCTGGAATTTACTGGGTTCATTCTCGAGAATGAACCCAGTAAATTCCAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000079680    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020049.2-818s1c1
Sequence:CCGGCCAGTGAACAGTATTGGGATACTCGAGTATCCCAATACTGTTCACTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)