EMAIL THIS PAGE TO A FRIEND

SLC6A15

solute carrier family 6 (neutral amino acid transporter), member 15

170 Gene Product Result for
Synonyms: NTT73 SBAT1 V7-3 hv7-3
UniProtKB ID: Q9H2J7, A8K592, B7Z2P7, E7ESJ5, Q9H9F5
Gene ID:
Human(55117) Summary: This gene encodes a member of the solute carrier family 6 protein family which transports neutral amino acids. The encoded protein is thought to play a role in neuronal amino acid transport (PMID: 16185194) and may be associated with major depression (PMID: 21521612). Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2012]
Mouse(103098) solute carrier family 6 (neurotransmitter transporter), member 15
Rat(282712) solute carrier family 6 (neutral amino acid transporter), member 15
domestic guinea pig(100731955) solute carrier family 6 (neutral amino acid transporter), member 15
naked mole-rat(101723219) solute carrier family 6 (neutral amino acid transporter), member 15
cow(281952) solute carrier family 6 (neutral amino acid transporter), member 15
sheep(101107008) solute carrier family 6 (neutral amino acid transporter), member 15
Zebrafish(565315) solute carrier family 6 (neutral amino acid transporter), member 15
domestic cat(101095111) solute carrier family 6 (neutral amino acid transporter), member 15
dog(475416) solute carrier family 6 (neutral amino acid transporter), member 15
chicken(417881) solute carrier family 6 (neutral amino acid transporter), member 15
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018057 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018057 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018057 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_175328 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175328 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175328 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018057 Rosetta Predictions human pricing
NM_182767 Rosetta Predictions human pricing
NM_172321 Rosetta Predictions rat pricing
NM_175328 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018057 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00174229 predicted 934
2 SASI_Hs01_00174230 predicted 775
3 SASI_Hs01_00174231 predicted 643
4 SASI_Hs01_00174232 predicted 877
5 SASI_Hs02_00351193 predicted 835
6 SASI_Hs01_00174233 predicted 645
7 SASI_Hs01_00174234 predicted 863
8 SASI_Hs01_00174235 predicted 880
9 SASI_Hs01_00174236 predicted 889
10 SASI_Hs01_00174237 predicted 710
11 SASI_Hs01_00174238 predicted 849
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182767 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00105812 predicted 937
2 SASI_Hs01_00105813 predicted 773
3 SASI_Hs01_00105814 predicted 641
4 SASI_Hs01_00105815 predicted 882
5 SASI_Hs02_00370936 predicted 843
6 SASI_Hs01_00105816 predicted 640
7 SASI_Hs01_00105817 predicted 865
8 SASI_Hs01_00105818 predicted 882
9 SASI_Hs01_00105819 predicted 892
10 SASI_Hs01_00105820 predicted 712
11 SASI_Hs01_00105821 predicted 850
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172321 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00081885 predicted 2660
2 SASI_Rn01_00081886 predicted 2517
3 SASI_Rn01_00081887 predicted 1692
4 SASI_Rn01_00081888 predicted 2363
5 SASI_Rn01_00081889 predicted 2028
6 SASI_Rn01_00081890 predicted 1293
7 SASI_Rn01_00081891 predicted 1088
8 SASI_Rn01_00081892 predicted 988
9 SASI_Rn01_00081893 predicted 1061
10 SASI_Rn01_00081894 predicted 2101
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175328 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00201236 predicted 1989
2 SASI_Mm02_00346108 predicted 2205
3 SASI_Mm02_00346109 predicted 2605
4 SASI_Mm01_00201238 predicted 1911
5 SASI_Mm01_00201239 predicted 754
6 SASI_Mm01_00201240 predicted 623
7 SASI_Mm01_00201241 predicted 843
8 SASI_Mm01_00201242 predicted 674
9 SASI_Mm01_00201243 predicted 2162
10 SASI_Mm01_00201244 predicted 2598
11 SASI_Mm01_00201237 predicted 2214
12 SASI_Mm01_00201245 predicted 2684
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018057
SLC6A15 MISSION shRNA Bacterial Glycerol Stock
solute carrier family 6 (neutral amino acid transporter), member 15
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000291637    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018057.5-876s21c1
Sequence:CCGGGCAGCATTGGTGTATGGAATTCTCGAGAATTCCATACACCAATGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291701    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018057.5-970s21c1
Sequence:CCGGCGTCATCATTGGCTGGAGTTTCTCGAGAAACTCCAGCCAATGATGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291636    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018057.5-1264s21c1
Sequence:CCGGGCCCTTCCTCATTCTGCTAATCTCGAGATTAGCAGAATGAGGAAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072803    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018057.3-2489s1c1
Sequence:CCGGCCCACCAATTAGTCAACTCTTCTCGAGAAGAGTTGACTAATTGGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018057.3-1232s1c1
Sequence:CCGGGCCCTTCCTCATTCTGCTAATCTCGAGATTAGCAGAATGAGGAAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018057.3-938s1c1
Sequence:CCGGCGTCATCATTGGCTGGAGTTTCTCGAGAAACTCCAGCCAATGATGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072806    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018057.3-723s1c1
Sequence:CCGGCCATACCTATGTCAGAAGAATCTCGAGATTCTTCTGACATAGGTATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072804    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018057.3-844s1c1
Sequence:CCGGGCAGCATTGGTGTATGGAATTCTCGAGAATTCCATACACCAATGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307750    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018057.5-755s21c1
Sequence:CCGGCCATACCTATGTCAGAAGAATCTCGAGATTCTTCTGACATAGGTATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018057
SLC6A15 MISSION shRNA shRNA Plasmid DNA
solute carrier family 6 (neutral amino acid transporter), member 15
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000291637    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018057.5-876s21c1
Sequence:CCGGGCAGCATTGGTGTATGGAATTCTCGAGAATTCCATACACCAATGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291701    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018057.5-970s21c1
Sequence:CCGGCGTCATCATTGGCTGGAGTTTCTCGAGAAACTCCAGCCAATGATGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291636    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018057.5-1264s21c1
Sequence:CCGGGCCCTTCCTCATTCTGCTAATCTCGAGATTAGCAGAATGAGGAAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072803    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018057.3-2489s1c1
Sequence:CCGGCCCACCAATTAGTCAACTCTTCTCGAGAAGAGTTGACTAATTGGTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018057.3-1232s1c1
Sequence:CCGGGCCCTTCCTCATTCTGCTAATCTCGAGATTAGCAGAATGAGGAAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018057.3-938s1c1
Sequence:CCGGCGTCATCATTGGCTGGAGTTTCTCGAGAAACTCCAGCCAATGATGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072806    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018057.3-723s1c1
Sequence:CCGGCCATACCTATGTCAGAAGAATCTCGAGATTCTTCTGACATAGGTATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072804    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018057.3-844s1c1
Sequence:CCGGGCAGCATTGGTGTATGGAATTCTCGAGAATTCCATACACCAATGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000307750    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018057.5-755s21c1
Sequence:CCGGCCATACCTATGTCAGAAGAATCTCGAGATTCTTCTGACATAGGTATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018057
SLC6A15 MISSION shRNA Lentiviral Transduction Particles
solute carrier family 6 (neutral amino acid transporter), member 15
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000291637    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018057.5-876s21c1
Sequence:CCGGGCAGCATTGGTGTATGGAATTCTCGAGAATTCCATACACCAATGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291701    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018057.5-970s21c1
Sequence:CCGGCGTCATCATTGGCTGGAGTTTCTCGAGAAACTCCAGCCAATGATGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291636    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018057.5-1264s21c1
Sequence:CCGGGCCCTTCCTCATTCTGCTAATCTCGAGATTAGCAGAATGAGGAAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072803    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018057.3-2489s1c1
Sequence:CCGGCCCACCAATTAGTCAACTCTTCTCGAGAAGAGTTGACTAATTGGTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018057.3-1232s1c1
Sequence:CCGGGCCCTTCCTCATTCTGCTAATCTCGAGATTAGCAGAATGAGGAAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018057.3-938s1c1
Sequence:CCGGCGTCATCATTGGCTGGAGTTTCTCGAGAAACTCCAGCCAATGATGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072806    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018057.3-723s1c1
Sequence:CCGGCCATACCTATGTCAGAAGAATCTCGAGATTCTTCTGACATAGGTATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072804    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018057.3-844s1c1
Sequence:CCGGGCAGCATTGGTGTATGGAATTCTCGAGAATTCCATACACCAATGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307750    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018057.5-755s21c1
Sequence:CCGGCCATACCTATGTCAGAAGAATCTCGAGATTCTTCTGACATAGGTATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175328
VALIDATED
SLC6A15 MISSION shRNA Bacterial Glycerol Stock
solute carrier family 6 (neutral amino acid transporter), member 15
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000079721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175328.1-1994s1c1
Sequence:CCGGCGTGACAATGTTTGACGATTACTCGAGTAATCGTCAAACATTGTCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000079720    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_175328.1-1850s1c1
Sequence:CCGGCGGCAGCATGTTTGGAACAATCTCGAGATTGTTCCAAACATGCTGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000079719    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_175328.1-2068s1c1
Sequence:CCGGGCTTTGTTTATGGCATAGATACTCGAGTATCTATGCCATAAACAAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000079722    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_175328.1-1995s1c1
Sequence:CCGGGTGACAATGTTTGACGATTATCTCGAGATAATCGTCAAACATTGTCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000079718    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_175328.1-2818s1c1
Sequence:CCGGGCTTACATTGACTGAGGTCATCTCGAGATGACCTCAGTCAATGTAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175328
VALIDATED
SLC6A15 MISSION shRNA shRNA Plasmid DNA
solute carrier family 6 (neutral amino acid transporter), member 15
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000079721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175328.1-1994s1c1
Sequence:CCGGCGTGACAATGTTTGACGATTACTCGAGTAATCGTCAAACATTGTCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000079720    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_175328.1-1850s1c1
Sequence:CCGGCGGCAGCATGTTTGGAACAATCTCGAGATTGTTCCAAACATGCTGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000079719    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_175328.1-2068s1c1
Sequence:CCGGGCTTTGTTTATGGCATAGATACTCGAGTATCTATGCCATAAACAAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000079722    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_175328.1-1995s1c1
Sequence:CCGGGTGACAATGTTTGACGATTATCTCGAGATAATCGTCAAACATTGTCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000079718    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_175328.1-2818s1c1
Sequence:CCGGGCTTACATTGACTGAGGTCATCTCGAGATGACCTCAGTCAATGTAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175328
VALIDATED
SLC6A15 MISSION shRNA Lentiviral Transduction Particles
solute carrier family 6 (neutral amino acid transporter), member 15
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000079721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175328.1-1994s1c1
Sequence:CCGGCGTGACAATGTTTGACGATTACTCGAGTAATCGTCAAACATTGTCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000079720    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_175328.1-1850s1c1
Sequence:CCGGCGGCAGCATGTTTGGAACAATCTCGAGATTGTTCCAAACATGCTGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000079719    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_175328.1-2068s1c1
Sequence:CCGGGCTTTGTTTATGGCATAGATACTCGAGTATCTATGCCATAAACAAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000079722    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_175328.1-1995s1c1
Sequence:CCGGGTGACAATGTTTGACGATTATCTCGAGATAATCGTCAAACATTGTCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000079718    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_175328.1-2818s1c1
Sequence:CCGGGCTTACATTGACTGAGGTCATCTCGAGATGACCTCAGTCAATGTAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)