EMAIL THIS PAGE TO A FRIEND

SLC6A1

solute carrier family 6 (neurotransmitter transporter), member 1

180 Gene Product Result for
Synonyms: GABATHG GABATR GAT1
UniProtKB ID: P30531, Q8N4K8
Gene ID:
Human(6529) Summary: The SLC6A1 gene encodes a gamma-aminobutyric acid (GABA) transporter, which removes GABA from the synaptic cleft (Hirunsatit et al., 2009 [PubMed 19077666]
Mouse(232333) solute carrier family 6 (neurotransmitter transporter, GABA), member 1
Rat(79212) solute carrier family 6 (neurotransmitter transporter), member 1
cow(407118) solute carrier family 6 (neurotransmitter transporter, GABA), member 1
sheep(101121462) solute carrier family 6 (neurotransmitter transporter, GABA), member 1
naked mole-rat(101716075) solute carrier family 6 (neurotransmitter transporter, GABA), member 1
domestic guinea pig(100731072) solute carrier family 6 (neurotransmitter transporter, GABA), member 1
chicken(415960) solute carrier family 6 (neurotransmitter transporter, GABA), member 1
Horse(100051613) solute carrier family 6 (neurotransmitter transporter, GABA), member 1
domestic cat(101088066) solute carrier family 6 (neurotransmitter transporter, GABA), member 1
dog(484655) solute carrier family 6 (neurotransmitter transporter, GABA), member 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AB1570W Anti-GABA Transporter-1 Antibody clone, Chemicon®, from rabbit rat, monkey, feline, mouse, human, rabbit
immunohistochemistry, western blot pricing
AB1570 Anti-GABA Transporter-1 Antibody, CT (a.a. 588-599) clone, Chemicon®, from rabbit mouse, rabbit, monkey, feline, rat, human
immunohistochemistry pricing
HPA013341 Anti-SLC6A1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution Antibody Enhanced Validation rat, human, mouse
immunohistochemistry, western blot pricing
SAB2102222 Anti-SLC6A1 antibody produced in rabbit affinity isolated antibody dog, rat, bovine, horse, human, mouse, guinea pig
immunohistochemistry, western blot pricing
SAB2105532 Anti-SLC6A1 antibody produced in rabbit affinity isolated antibody dog, rat, human, guinea pig, horse, bovine, mouse
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178703 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178703 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178703 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003042 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003042 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003042 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003042 Rosetta Predictions human pricing
NM_024371 Rosetta Predictions rat pricing
NM_178703 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003042 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00023081 predicted 807
2 SASI_Hs01_00023083 predicted 1114
3 SASI_Hs01_00023084 predicted 929
4 SASI_Hs01_00023085 predicted 1844
5 SASI_Hs01_00023088 predicted 1333
6 SASI_Hs02_00334952 predicted 1805
7 SASI_Hs02_00334953 predicted 2131
8 SASI_Hs01_00023089 predicted 1837
9 SASI_Hs01_00023090 predicted 565
10 SASI_Hs02_00334954 predicted 793
11 SASI_Hs01_00023082 predicted 2041
12 SASI_Hs01_00023086 predicted 1709
13 SASI_Hs01_00023087 predicted 1942
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024371 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00042114 predicted 1570
2 SASI_Rn01_00042115 predicted 734
3 SASI_Rn01_00042116 predicted 396
4 SASI_Rn01_00042117 predicted 1437
5 SASI_Rn01_00042118 predicted 671
6 SASI_Rn01_00042119 predicted 1075
7 SASI_Rn01_00042120 predicted 1663
8 SASI_Rn01_00042121 predicted 1105
9 SASI_Rn01_00042122 predicted 1318
10 SASI_Rn01_00042123 predicted 987
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178703 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00076961 predicted 671
2 SASI_Mm01_00076962 predicted 485
3 SASI_Mm01_00076963 predicted 1535
4 SASI_Mm01_00076964 predicted 1754
5 SASI_Mm01_00076965 predicted 772
6 SASI_Mm01_00076966 predicted 1162
7 SASI_Mm01_00076967 predicted 1417
8 SASI_Mm01_00076968 predicted 1077
9 SASI_Mm01_00076969 predicted 394
10 SASI_Mm01_00076970 predicted 1670
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178703
SLC6A1 MISSION shRNA Bacterial Glycerol Stock
solute carrier family 6 (neurotransmitter transporter), member 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000079834    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178703.2-775s1c1
Sequence:CCGGCCTGGTCAATACCACCAACATCTCGAGATGTTGGTGGTATTGACCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000079837    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178703.2-1533s1c1
Sequence:CCGGCCTACCTGATTGGCCTGTCTACTCGAGTAGACAGGCCAATCAGGTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000079833    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178703.2-3691s1c1
Sequence:CCGGGCAGTGTATTTCATGTTTGTACTCGAGTACAAACATGAAATACACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000079835    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178703.2-1534s1c1
Sequence:CCGGCTACCTGATTGGCCTGTCTAACTCGAGTTAGACAGGCCAATCAGGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000079836    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178703.2-1045s1c1
Sequence:CCGGCCTCTTCTACATCACACCCAACTCGAGTTGGGTGTGATGTAGAAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178703
SLC6A1 MISSION shRNA shRNA Plasmid DNA
solute carrier family 6 (neurotransmitter transporter), member 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000079834    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178703.2-775s1c1
Sequence:CCGGCCTGGTCAATACCACCAACATCTCGAGATGTTGGTGGTATTGACCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000079837    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178703.2-1533s1c1
Sequence:CCGGCCTACCTGATTGGCCTGTCTACTCGAGTAGACAGGCCAATCAGGTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000079833    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178703.2-3691s1c1
Sequence:CCGGGCAGTGTATTTCATGTTTGTACTCGAGTACAAACATGAAATACACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000079835    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178703.2-1534s1c1
Sequence:CCGGCTACCTGATTGGCCTGTCTAACTCGAGTTAGACAGGCCAATCAGGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000079836    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178703.2-1045s1c1
Sequence:CCGGCCTCTTCTACATCACACCCAACTCGAGTTGGGTGTGATGTAGAAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178703
SLC6A1 MISSION shRNA Lentiviral Transduction Particles
solute carrier family 6 (neurotransmitter transporter), member 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000079834    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178703.2-775s1c1
Sequence:CCGGCCTGGTCAATACCACCAACATCTCGAGATGTTGGTGGTATTGACCAGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000079837    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178703.2-1533s1c1
Sequence:CCGGCCTACCTGATTGGCCTGTCTACTCGAGTAGACAGGCCAATCAGGTAGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000079833    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178703.2-3691s1c1
Sequence:CCGGGCAGTGTATTTCATGTTTGTACTCGAGTACAAACATGAAATACACTGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000079835    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178703.2-1534s1c1
Sequence:CCGGCTACCTGATTGGCCTGTCTAACTCGAGTTAGACAGGCCAATCAGGTAGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000079836    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178703.2-1045s1c1
Sequence:CCGGCCTCTTCTACATCACACCCAACTCGAGTTGGGTGTGATGTAGAAGAGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003042
SLC6A1 MISSION shRNA Bacterial Glycerol Stock
solute carrier family 6 (neurotransmitter transporter), member 1
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000042877    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003042.2-1864s1c1
Sequence:CCGGGTGGAAACTCTGCTGGTCTTTCTCGAGAAAGACCAGCAGAGTTTCCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003042.2-772s1c1
Sequence:CCGGGCTATCATTCTGGCTGAACATCTCGAGATGTTCAGCCAGAATGATAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042874    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003042.2-1810s1c1
Sequence:CCGGCAACCGATTCTATGACAATATCTCGAGATATTGTCATAGAATCGGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042875    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003042.2-1186s1c1
Sequence:CCGGCTTCTACATCACACCCAACTTCTCGAGAAGTTGGGTGTGATGTAGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003042.2-1300s1c1
Sequence:CCGGGAGCTACAACTCTTTCCACAACTCGAGTTGTGGAAAGAGTTGTAGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429875    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003042.3-2070s21c1
Sequence:CCGGCTACATGTTCCTCACCTTAAACTCGAGTTTAAGGTGAGGAACATGTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003042
SLC6A1 MISSION shRNA shRNA Plasmid DNA
solute carrier family 6 (neurotransmitter transporter), member 1
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000042877    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003042.2-1864s1c1
Sequence:CCGGGTGGAAACTCTGCTGGTCTTTCTCGAGAAAGACCAGCAGAGTTTCCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003042.2-772s1c1
Sequence:CCGGGCTATCATTCTGGCTGAACATCTCGAGATGTTCAGCCAGAATGATAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042874    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003042.2-1810s1c1
Sequence:CCGGCAACCGATTCTATGACAATATCTCGAGATATTGTCATAGAATCGGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042875    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003042.2-1186s1c1
Sequence:CCGGCTTCTACATCACACCCAACTTCTCGAGAAGTTGGGTGTGATGTAGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003042.2-1300s1c1
Sequence:CCGGGAGCTACAACTCTTTCCACAACTCGAGTTGTGGAAAGAGTTGTAGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429875    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003042.3-2070s21c1
Sequence:CCGGCTACATGTTCCTCACCTTAAACTCGAGTTTAAGGTGAGGAACATGTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003042
SLC6A1 MISSION shRNA Lentiviral Transduction Particles
solute carrier family 6 (neurotransmitter transporter), member 1
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000042877    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003042.2-1864s1c1
Sequence:CCGGGTGGAAACTCTGCTGGTCTTTCTCGAGAAAGACCAGCAGAGTTTCCACTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000042873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003042.2-772s1c1
Sequence:CCGGGCTATCATTCTGGCTGAACATCTCGAGATGTTCAGCCAGAATGATAGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000042874    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003042.2-1810s1c1
Sequence:CCGGCAACCGATTCTATGACAATATCTCGAGATATTGTCATAGAATCGGTTGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000042875    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003042.2-1186s1c1
Sequence:CCGGCTTCTACATCACACCCAACTTCTCGAGAAGTTGGGTGTGATGTAGAAGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000042876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003042.2-1300s1c1
Sequence:CCGGGAGCTACAACTCTTTCCACAACTCGAGTTGTGGAAAGAGTTGTAGCTCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000429875    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003042.3-2070s21c1
Sequence:CCGGCTACATGTTCCTCACCTTAAACTCGAGTTTAAGGTGAGGAACATGTAGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???