EMAIL THIS PAGE TO A FRIEND

SLC6A2

solute carrier family 6 (neurotransmitter transporter), member 2

117 Gene Product Result for
Synonyms: NAT1 NET NET1 SLC6A5
UniProtKB ID: P23975, B2R707, Q96KH8
Gene ID:
Human(6530) Summary: This gene encodes a member of the sodium:neurotransmitter symporter family. This member is a multi-pass membrane protein, which is responsible for reuptake of norepinephrine into presynaptic nerve terminals and is a regulator of norepinephrine homeostasis. Mutations in this gene cause orthostatic intolerance, a syndrome characterized by lightheadedness, fatigue, altered mentation and syncope. Alternatively spliced transcript variants encoding different isoforms have been identified in this gene.[provided by RefSeq, Feb 2010]
Mouse(20538) solute carrier family 6 (neurotransmitter transporter, noradrenalin), member 2
Rat(83511) solute carrier family 6 (neurotransmitter transporter), member 2
chicken(395458) solute carrier family 6 (neurotransmitter transporter, noradrenalin), member 2
dog(487272) solute carrier family 6 (neurotransmitter transporter, noradrenalin), member 2
domestic cat(493768) solute carrier family 6 (neurotransmitter transporter, noradrenalin), member 2
Horse(100061346) solute carrier family 6 (neurotransmitter transporter, noradrenalin), member 2
domestic cat(101099605) solute carrier family 6 (neurotransmitter transporter, noradrenalin), member 2
cow(282363) solute carrier family 6 (neurotransmitter transporter, noradrenalin), member 2
sheep(443100) solute carrier family 6 (neurotransmitter transporter, noradrenalin), member 2
sheep(101116078) solute carrier family 6 (neurotransmitter transporter, noradrenalin), member 2
Domestic Rabbit(100328959) solute carrier family 6 (neurotransmitter transporter, noradrenalin), member 2
naked mole-rat(101716834) solute carrier family 6 (neurotransmitter transporter, noradrenalin), member 2
domestic guinea pig(100723578) solute carrier family 6 (neurotransmitter transporter, noradrenalin), member 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
C8912 Cocaine free base human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009209 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009209 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009209 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001043 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001043 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001043 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU097611 MISSION® esiRNA esiRNA human SLC6A2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001043 Rosetta Predictions human pricing
NM_031343 Rosetta Predictions rat pricing
NM_009209 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001043 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00180217 predicted 1031
2 SASI_Hs01_00180218 predicted 648
3 SASI_Hs01_00180220 predicted 1023
4 SASI_Hs01_00180221 predicted 971
5 SASI_Hs01_00180223 predicted 1336
6 SASI_Hs01_00180224 predicted 1589
7 SASI_Hs01_00180225 predicted 1863
8 SASI_Hs01_00180226 predicted 1379
9 SASI_Hs02_00311239 predicted 1437
10 SASI_Hs02_00311240 predicted 946
11 SASI_Hs01_00180219 predicted 1193
12 SASI_Hs01_00180222 predicted 1254
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031343 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00093550 predicted 323
2 SASI_Rn02_00264578 predicted 1867
3 SASI_Rn02_00264579 predicted 1189
4 SASI_Rn01_00093552 predicted 1026
5 SASI_Rn01_00093553 predicted 842
6 SASI_Rn01_00093554 predicted 1025
7 SASI_Rn01_00093555 predicted 1670
8 SASI_Rn01_00093556 predicted 1162
9 SASI_Rn01_00093557 predicted 1650
10 SASI_Rn01_00093558 predicted 1388
11 SASI_Rn01_00093549 predicted 773
12 SASI_Rn01_00093551 predicted 1512
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009209 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00315590 predicted 1331
2 SASI_Mm02_00315591 predicted 2013
3 SASI_Mm02_00315592 predicted 1165
4 SASI_Mm02_00315593 predicted 484
5 SASI_Mm02_00315594 predicted 1294
6 SASI_Mm02_00315595 predicted 1183
7 SASI_Mm02_00315596 predicted 2040
8 SASI_Mm02_00315597 predicted 1185
9 SASI_Mm02_00315598 predicted 795
10 SASI_Mm02_00315599 predicted 1009
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009209
SLC6A2 MISSION shRNA Bacterial Glycerol Stock
solute carrier family 6 (neurotransmitter transporter), member 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000079311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009209.2-1468s1c1
Sequence:CCGGGCGGTGCTTATGGAAGCTATTCTCGAGAATAGCTTCCATAAGCACCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000079312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009209.2-612s1c1
Sequence:CCGGCCATACCAAATACTCCAAATACTCGAGTATTTGGAGTATTTGGTATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000079310    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009209.2-1123s1c1
Sequence:CCGGGCCCATGAACATAAGGTCAATCTCGAGATTGACCTTATGTTCATGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000079308    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009209.2-5171s1c1
Sequence:CCGGGCTCGGCATTTAGAGTTGATTCTCGAGAATCAACTCTAAATGCCGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000079309    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009209.2-1124s1c1
Sequence:CCGGCCCATGAACATAAGGTCAATACTCGAGTATTGACCTTATGTTCATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009209
SLC6A2 MISSION shRNA shRNA Plasmid DNA
solute carrier family 6 (neurotransmitter transporter), member 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000079311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009209.2-1468s1c1
Sequence:CCGGGCGGTGCTTATGGAAGCTATTCTCGAGAATAGCTTCCATAAGCACCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000079312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009209.2-612s1c1
Sequence:CCGGCCATACCAAATACTCCAAATACTCGAGTATTTGGAGTATTTGGTATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000079310    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009209.2-1123s1c1
Sequence:CCGGGCCCATGAACATAAGGTCAATCTCGAGATTGACCTTATGTTCATGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000079308    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009209.2-5171s1c1
Sequence:CCGGGCTCGGCATTTAGAGTTGATTCTCGAGAATCAACTCTAAATGCCGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000079309    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009209.2-1124s1c1
Sequence:CCGGCCCATGAACATAAGGTCAATACTCGAGTATTGACCTTATGTTCATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009209
SLC6A2 MISSION shRNA Lentiviral Transduction Particles
solute carrier family 6 (neurotransmitter transporter), member 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000079311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009209.2-1468s1c1
Sequence:CCGGGCGGTGCTTATGGAAGCTATTCTCGAGAATAGCTTCCATAAGCACCGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000079312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009209.2-612s1c1
Sequence:CCGGCCATACCAAATACTCCAAATACTCGAGTATTTGGAGTATTTGGTATGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000079310    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009209.2-1123s1c1
Sequence:CCGGGCCCATGAACATAAGGTCAATCTCGAGATTGACCTTATGTTCATGGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000079308    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009209.2-5171s1c1
Sequence:CCGGGCTCGGCATTTAGAGTTGATTCTCGAGAATCAACTCTAAATGCCGAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000079309    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009209.2-1124s1c1
Sequence:CCGGCCCATGAACATAAGGTCAATACTCGAGTATTGACCTTATGTTCATGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001043
SLC6A2 MISSION shRNA Bacterial Glycerol Stock
solute carrier family 6 (neurotransmitter transporter), member 2
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000043576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001043.1-1156s1c1
Sequence:CCGGCCATGAACACAAGGTCAACATCTCGAGATGTTGACCTTGTGTTCATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043574    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001043.1-337s1c1
Sequence:CCGGCCCGTACACACTGTTCCTTATCTCGAGATAAGGAACAGTGTGTACGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043575    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001043.1-1756s1c1
Sequence:CCGGGCCCATCTACGTCATCTATAACTCGAGTTATAGATGACGTAGATGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043573    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001043.1-1010s1c1
Sequence:CCGGGCTGGATTTGGAGTATTGATTCTCGAGAATCAATACTCCAAATCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001043.1-643s1c1
Sequence:CCGGCCACACCAAGTACTCCAAGTACTCGAGTACTTGGAGTACTTGGTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435137    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001043.3-2426s21c1
Sequence:CCGGACCACATTTGCCTAGACTTTGCTCGAGCAAAGTCTAGGCAAATGTGGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432670    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001043.3-2401s21c1
Sequence:CCGGTAGGTTCATGAGGTCGGAAATCTCGAGATTTCCGACCTCATGAACCTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001043
SLC6A2 MISSION shRNA shRNA Plasmid DNA
solute carrier family 6 (neurotransmitter transporter), member 2
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000043576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001043.1-1156s1c1
Sequence:CCGGCCATGAACACAAGGTCAACATCTCGAGATGTTGACCTTGTGTTCATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043574    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001043.1-337s1c1
Sequence:CCGGCCCGTACACACTGTTCCTTATCTCGAGATAAGGAACAGTGTGTACGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043575    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001043.1-1756s1c1
Sequence:CCGGGCCCATCTACGTCATCTATAACTCGAGTTATAGATGACGTAGATGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043573    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001043.1-1010s1c1
Sequence:CCGGGCTGGATTTGGAGTATTGATTCTCGAGAATCAATACTCCAAATCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001043.1-643s1c1
Sequence:CCGGCCACACCAAGTACTCCAAGTACTCGAGTACTTGGAGTACTTGGTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000435137    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001043.3-2426s21c1
Sequence:CCGGACCACATTTGCCTAGACTTTGCTCGAGCAAAGTCTAGGCAAATGTGGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000432670    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001043.3-2401s21c1
Sequence:CCGGTAGGTTCATGAGGTCGGAAATCTCGAGATTTCCGACCTCATGAACCTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001043
SLC6A2 MISSION shRNA Lentiviral Transduction Particles
solute carrier family 6 (neurotransmitter transporter), member 2
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000043576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001043.1-1156s1c1
Sequence:CCGGCCATGAACACAAGGTCAACATCTCGAGATGTTGACCTTGTGTTCATGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043574    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001043.1-337s1c1
Sequence:CCGGCCCGTACACACTGTTCCTTATCTCGAGATAAGGAACAGTGTGTACGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043575    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001043.1-1756s1c1
Sequence:CCGGGCCCATCTACGTCATCTATAACTCGAGTTATAGATGACGTAGATGGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043573    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001043.1-1010s1c1
Sequence:CCGGGCTGGATTTGGAGTATTGATTCTCGAGAATCAATACTCCAAATCCAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001043.1-643s1c1
Sequence:CCGGCCACACCAAGTACTCCAAGTACTCGAGTACTTGGAGTACTTGGTGTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000435137    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001043.3-2426s21c1
Sequence:CCGGACCACATTTGCCTAGACTTTGCTCGAGCAAAGTCTAGGCAAATGTGGTTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000432670    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001043.3-2401s21c1
Sequence:CCGGTAGGTTCATGAGGTCGGAAATCTCGAGATTTCCGACCTCATGAACCTATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)