EMAIL THIS PAGE TO A FRIEND

SLC6A3

solute carrier family 6 (neurotransmitter transporter), member 3

106 Gene Product Result for
Synonyms: DAT DAT1 PKDYS
UniProtKB ID: Q01959, A2RUN4, Q14996
Gene ID:
Human(6531) Summary: This gene encodes a dopamine transporter which is a member of the sodium- and chloride-dependent neurotransmitter transporter family. The 3' UTR of this gene contains a 40 bp tandem repeat, referred to as a variable number tandem repeat or VNTR, which can be present in 3 to 11 copies. Variation in the number of repeats is associated with idiopathic epilepsy, attention-deficit hyperactivity disorder, dependence on alcohol and cocaine, susceptibility to Parkinson disease and protection against nicotine dependence.[provided by RefSeq, Nov 2009]
Mouse(13162) solute carrier family 6 (neurotransmitter transporter, dopamine), member 3
Rat(24898) solute carrier family 6 (neurotransmitter transporter), member 3
Zebrafish(80787) solute carrier family 6 (neurotransmitter transporter, dopamine), member 3
Horse(100054747) solute carrier family 6 (neurotransmitter transporter, dopamine), member 3
domestic cat(101101618) solute carrier family 6 (neurotransmitter transporter, dopamine), member 3
dog(609304) solute carrier family 6 (neurotransmitter transporter, dopamine), member 3
cow(788410) solute carrier family 6 (neurotransmitter transporter, dopamine), member 3
sheep(101111908) solute carrier family 6 (neurotransmitter transporter, dopamine), member 3
naked mole-rat(101709245) solute carrier family 6 (neurotransmitter transporter, dopamine), member 3
domestic guinea pig(100714898) solute carrier family 6 (neurotransmitter transporter, dopamine), member 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA013602 Anti-DAT antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
D6944 Anti-Dopamine Transporter (N-terminal) antibody produced in rabbit ~1.0 mg/mL, affinity isolated antibody, buffered aqueous solution mouse (predicted), human, rat
immunofluorescence, western blot pricing
D2442 Anti-Dopamine Transporter antibody produced in rabbit whole antiserum monkey, canine, human, mouse
immunohistochemistry, immunoprecipitation (IP), western blot pricing
D9567 Anti-Dopamine Transporter, C-Terminus antibody produced in rabbit affinity isolated antibody, buffered aqueous glycerol solution human, monkey
immunohistochemistry, western blot pricing
D9442 Anti-Dopamine Transporter, Extracellular Loop 2 antibody produced in rabbit affinity isolated antibody, buffered aqueous glycerol solution human, monkey
immunohistochemistry, western blot pricing
SAB2502027 Anti-SLC6A3 antibody produced in goat affinity isolated antibody, buffered aqueous solution human
ELISA, western blot pricing
HPA012763 Anti-SLC6A3 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody human
immunohistochemistry pricing
AMAB91125 Monoclonal Anti-DAT antibody produced in mouse Prestige Antibodies® Powered by Atlas Antibodies, clone CL3123, purified immunoglobulin, buffered aqueous glycerol solution mouse, human, rat
immunohistochemistry pricing

Small Molecule - Blocker

Product # Description Species Add to Cart
 
B138 BTCP hydrochloride human pricing

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
C8912 Cocaine free base human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001044 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001044 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001044 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010020 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010020 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010020 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU098891 MISSION® esiRNA esiRNA human SLC6A3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001044 Rosetta Predictions human pricing
NM_012694 Rosetta Predictions rat pricing
NM_010020 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001044 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00060930 predicted 1609
2 SASI_Hs01_00060931 predicted 2045
3 SASI_Hs01_00060932 predicted 1004
4 SASI_Hs01_00060934 predicted 565
5 SASI_Hs01_00060935 predicted 2121
6 SASI_Hs01_00060936 predicted 2253
7 SASI_Hs01_00060937 predicted 313
8 SASI_Hs01_00060938 predicted 1523
9 SASI_Hs01_00060939 predicted 1948
10 SASI_Hs02_00311291 predicted 2189
11 SASI_Hs01_00060933 predicted 2085
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012694 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00074328 predicted 217
2 SASI_Rn01_00074330 predicted 486
3 SASI_Rn01_00074331 predicted 1430
4 SASI_Rn01_00074332 predicted 1484
5 SASI_Rn01_00074333 predicted 530
6 SASI_Rn01_00074335 predicted 1507
7 SASI_Rn02_00260001 predicted 1579
8 SASI_Rn02_00260002 predicted 849
9 SASI_Rn02_00260003 predicted 1094
10 SASI_Rn02_00260004 predicted 846
11 SASI_Rn01_00074326 predicted 1048
12 SASI_Rn01_00074327 predicted 1545
13 SASI_Rn01_00074329 predicted 1064
14 SASI_Rn01_00074334 predicted 1778
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010020 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00102835 predicted 293
2 SASI_Mm01_00102837 predicted 1637
3 SASI_Mm01_00102838 predicted 1790
4 SASI_Mm01_00102839 predicted 350
5 SASI_Mm01_00102840 predicted 1512
6 SASI_Mm01_00102842 predicted 1167
7 SASI_Mm01_00102843 predicted 1639
8 SASI_Mm02_00317642 predicted 1603
9 SASI_Mm01_00102844 predicted 599
10 SASI_Mm02_00317643 predicted 1657
11 SASI_Mm01_00102836 predicted 1553
12 SASI_Mm01_00102841 predicted 1479
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001044
SLC6A3 MISSION shRNA Bacterial Glycerol Stock
solute carrier family 6 (neurotransmitter transporter), member 3
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000038279    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001044.2-3236s1c1
Sequence:CCGGGCCACATCAATAACAACAGTTCTCGAGAACTGTTGTTATTGATGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433264    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001044.4-329s21c1
Sequence:CCGGACTTTCTCCTGTCCGTCATTGCTCGAGCAATGACGGACAGGAGAAAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422610    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001044.4-2418s21c1
Sequence:CCGGCCATTTACTTTGCCCATATTACTCGAGTAATATGGGCAAAGTAAATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001044.2-1163s1c1
Sequence:CCGGCGCGATTGTCACCACCTCCATCTCGAGATGGAGGTGGTGACAATCGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001044.2-536s1c1
Sequence:CCGGCATACTGAAAGGTGTGGGCTTCTCGAGAAGCCCACACCTTTCAGTATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038283    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001044.2-431s1c1
Sequence:CCGGCTACCTGCTCTTCATGGTCATCTCGAGATGACCATGAAGAGCAGGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038280    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001044.2-1878s1c1
Sequence:CCGGCCTGGGTCCTTTCGAGAGAAACTCGAGTTTCTCTCGAAAGGACCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428616    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001044.4-1523s21c1
Sequence:CCGGACGGTGGCATCTACGTCTTCACTCGAGTGAAGACGTAGATGCCACCGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413780    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001044.4-2464s21c1
Sequence:CCGGAGCTGTGCAGAAGGTGAAATGCTCGAGCATTTCACCTTCTGCACAGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420852    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001044.4-2037s21c1
Sequence:CCGGACACGAACAAACCAAGGAAATCTCGAGATTTCCTTGGTTTGTTCGTGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001044
SLC6A3 MISSION shRNA shRNA Plasmid DNA
solute carrier family 6 (neurotransmitter transporter), member 3
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000038279    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001044.2-3236s1c1
Sequence:CCGGGCCACATCAATAACAACAGTTCTCGAGAACTGTTGTTATTGATGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433264    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001044.4-329s21c1
Sequence:CCGGACTTTCTCCTGTCCGTCATTGCTCGAGCAATGACGGACAGGAGAAAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422610    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001044.4-2418s21c1
Sequence:CCGGCCATTTACTTTGCCCATATTACTCGAGTAATATGGGCAAAGTAAATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000038282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001044.2-1163s1c1
Sequence:CCGGCGCGATTGTCACCACCTCCATCTCGAGATGGAGGTGGTGACAATCGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000038281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001044.2-536s1c1
Sequence:CCGGCATACTGAAAGGTGTGGGCTTCTCGAGAAGCCCACACCTTTCAGTATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000038283    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001044.2-431s1c1
Sequence:CCGGCTACCTGCTCTTCATGGTCATCTCGAGATGACCATGAAGAGCAGGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000038280    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001044.2-1878s1c1
Sequence:CCGGCCTGGGTCCTTTCGAGAGAAACTCGAGTTTCTCTCGAAAGGACCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428616    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001044.4-1523s21c1
Sequence:CCGGACGGTGGCATCTACGTCTTCACTCGAGTGAAGACGTAGATGCCACCGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413780    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001044.4-2464s21c1
Sequence:CCGGAGCTGTGCAGAAGGTGAAATGCTCGAGCATTTCACCTTCTGCACAGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420852    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001044.4-2037s21c1
Sequence:CCGGACACGAACAAACCAAGGAAATCTCGAGATTTCCTTGGTTTGTTCGTGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001044
SLC6A3 MISSION shRNA Lentiviral Transduction Particles
solute carrier family 6 (neurotransmitter transporter), member 3
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000038279    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001044.2-3236s1c1
Sequence:CCGGGCCACATCAATAACAACAGTTCTCGAGAACTGTTGTTATTGATGTGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433264    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001044.4-329s21c1
Sequence:CCGGACTTTCTCCTGTCCGTCATTGCTCGAGCAATGACGGACAGGAGAAAGTTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422610    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001044.4-2418s21c1
Sequence:CCGGCCATTTACTTTGCCCATATTACTCGAGTAATATGGGCAAAGTAAATGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000038282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001044.2-1163s1c1
Sequence:CCGGCGCGATTGTCACCACCTCCATCTCGAGATGGAGGTGGTGACAATCGCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000038281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001044.2-536s1c1
Sequence:CCGGCATACTGAAAGGTGTGGGCTTCTCGAGAAGCCCACACCTTTCAGTATGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000038283    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001044.2-431s1c1
Sequence:CCGGCTACCTGCTCTTCATGGTCATCTCGAGATGACCATGAAGAGCAGGTAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000038280    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001044.2-1878s1c1
Sequence:CCGGCCTGGGTCCTTTCGAGAGAAACTCGAGTTTCTCTCGAAAGGACCCAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428616    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001044.4-1523s21c1
Sequence:CCGGACGGTGGCATCTACGTCTTCACTCGAGTGAAGACGTAGATGCCACCGTTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413780    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001044.4-2464s21c1
Sequence:CCGGAGCTGTGCAGAAGGTGAAATGCTCGAGCATTTCACCTTCTGCACAGCTTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420852    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001044.4-2037s21c1
Sequence:CCGGACACGAACAAACCAAGGAAATCTCGAGATTTCCTTGGTTTGTTCGTGTTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010020
SLC6A3 MISSION shRNA Bacterial Glycerol Stock
solute carrier family 6 (neurotransmitter transporter), member 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000070081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010020.2-717s1c1
Sequence:CCGGCCAACTGCTCTGATGCACATACTCGAGTATGTGCATCAGAGCAGTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070078    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010020.2-1870s1c1
Sequence:CCGGGCCCATTTATGCCACCTATAACTCGAGTTATAGGTGGCATAAATGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010020.2-1592s1c1
Sequence:CCGGGCTGGCACATCTATCCTCTTTCTCGAGAAAGAGGATAGATGTGCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070079    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010020.2-1657s1c1
Sequence:CCGGCCAGCAATTCAGTGATGACATCTCGAGATGTCATCACTGAATTGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070080    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010020.2-889s1c1
Sequence:CCGGGCTGGTCATTGTTCTGCTCTACTCGAGTAGAGCAGAACAATGACCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010020
SLC6A3 MISSION shRNA shRNA Plasmid DNA
solute carrier family 6 (neurotransmitter transporter), member 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000070081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010020.2-717s1c1
Sequence:CCGGCCAACTGCTCTGATGCACATACTCGAGTATGTGCATCAGAGCAGTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070078    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010020.2-1870s1c1
Sequence:CCGGGCCCATTTATGCCACCTATAACTCGAGTTATAGGTGGCATAAATGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010020.2-1592s1c1
Sequence:CCGGGCTGGCACATCTATCCTCTTTCTCGAGAAAGAGGATAGATGTGCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070079    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010020.2-1657s1c1
Sequence:CCGGCCAGCAATTCAGTGATGACATCTCGAGATGTCATCACTGAATTGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070080    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010020.2-889s1c1
Sequence:CCGGGCTGGTCATTGTTCTGCTCTACTCGAGTAGAGCAGAACAATGACCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010020
SLC6A3 MISSION shRNA Lentiviral Transduction Particles
solute carrier family 6 (neurotransmitter transporter), member 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000070081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010020.2-717s1c1
Sequence:CCGGCCAACTGCTCTGATGCACATACTCGAGTATGTGCATCAGAGCAGTTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070078    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010020.2-1870s1c1
Sequence:CCGGGCCCATTTATGCCACCTATAACTCGAGTTATAGGTGGCATAAATGGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010020.2-1592s1c1
Sequence:CCGGGCTGGCACATCTATCCTCTTTCTCGAGAAAGAGGATAGATGTGCCAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070079    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010020.2-1657s1c1
Sequence:CCGGCCAGCAATTCAGTGATGACATCTCGAGATGTCATCACTGAATTGCTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070080    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010020.2-889s1c1
Sequence:CCGGGCTGGTCATTGTTCTGCTCTACTCGAGTAGAGCAGAACAATGACCAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)