EMAIL THIS PAGE TO A FRIEND

SLC6A4

solute carrier family 6 (neurotransmitter transporter), member 4

224 Gene Product Result for
Synonyms: 5-HTT 5-HTTLPR 5HTT HTT OCD1 SERT SERT1 hSERT
UniProtKB ID: P31645, Q5EE02
Gene ID:
Human(6532) Summary: This gene encodes an integral membrane protein that transports the neurotransmitter serotonin from synaptic spaces into presynaptic neurons. The encoded protein terminates the action of serotonin and recycles it in a sodium-dependent manner. This protein is a target of psychomotor stimulants, such as amphetamines and cocaine, and is a member of the sodium:neurotransmitter symporter family. A repeat length polymorphism in the promoter of this gene has been shown to affect the rate of serotonin uptake and may play a role in sudden infant death syndrome, aggressive behavior in Alzheimer disease patients, and depression-susceptibility in people experiencing emotional trauma. [provided by RefSeq, Jul 2008]
Mouse(15567) solute carrier family 6 (neurotransmitter transporter, serotonin), member 4
Rat(25553) solute carrier family 6 (neurotransmitter transporter), member 4
domestic guinea pig(100135619) solute carrier family 6 (neurotransmitter transporter, serotonin), member 4
naked mole-rat(101705584) solute carrier family 6 (neurotransmitter transporter, serotonin), member 4
Domestic Rabbit(100340600) solute carrier family 6 (neurotransmitter transporter, serotonin), member 4
Domestic Rabbit(100351801) solute carrier family 6 (neurotransmitter transporter, serotonin), member 4
cow(282365) solute carrier family 6 (neurotransmitter transporter, serotonin), member 4
chicken(404747) solute carrier family 6 (neurotransmitter transporter, serotonin), member 4
Horse(100053721) solute carrier family 6 (neurotransmitter transporter, serotonin), member 4
domestic cat(101091163) solute carrier family 6 (neurotransmitter transporter, serotonin), member 4
dog(491184) solute carrier family 6 (neurotransmitter transporter, serotonin), member 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
MAB5492 Anti-Huntingtin Antibody, a.a. 1-82 ascites fluid, clone 2B4, Chemicon® human
ELISA, immunocytochemistry, immunohistochemistry, western blot pricing
MAB5490 Anti-Huntingtin Antibody, a.a. 115-129 ascites fluid, Chemicon® human
ELISA, immunocytochemistry, immunohistochemistry, western blot pricing
AB9562 Anti-Huntingtin phosphoSer 421 Antibody Chemicon®, from rabbit human
western blot pricing
MAB2170 Anti-Huntingtin Protein Antibody, a.a. 1247-1646, clone HU-4E6 ascites fluid, clone HU-4E6, Chemicon® mouse, human
ELISA, immunocytochemistry, immunohistochemistry, immunoprecipitation (IP), western blot pricing
MAB2166 Anti-Huntingtin Protein Antibody, a.a. 181-810, clone 1HU-4C8 ascites fluid, clone 1HU-4C8, Chemicon® rat, rabbit
ELISA, immunocytochemistry, immunohistochemistry, immunoprecipitation (IP), western blot pricing
MAB2168 Anti-Huntingtin Protein Antibody, a.a. 2146-2541, clone HU-2E8 ascites fluid, clone HU-2E8, Chemicon® monkey, human
ELISA, immunocytochemistry, immunohistochemistry, western blot pricing
MAB5374 Anti-Huntingtin Protein Antibody, clone mEM48 culture supernatant, clone mEM48, Chemicon® human
immunocytochemistry, immunohistochemistry, western blot pricing
SAB4200039 Anti-Serotonin Transporter (N-terminal) antibody produced in rabbit ~1.5 mg/mL, affinity isolated antibody, buffered aqueous solution human
western blot pricing
AB9726 Anti-Serotonin Transporter Antibody serum, Chemicon® mouse, rat
immunohistochemistry, immunoprecipitation (IP), western blot pricing
AB1594P Anti-Serotonin Transporter Antibody Chemicon®, from rabbit human, rat
ELISA, western blot pricing
MAB5618 Anti-Serotonin Transporter Antibody ascites fluid, Chemicon® human, primate
immunohistochemistry pricing
MAB1564 Anti-Serotonin Transporter Antibody, clone 17-7A4 clone 17-7A4, Chemicon®, from mouse rat
immunohistochemistry pricing
SAB2502028 Anti-SLC6A4 (C-terminal) antibody produced in goat affinity isolated antibody, buffered aqueous solution bovine, human, mouse, rat
ELISA, flow cytometry, immunofluorescence pricing
HPA074728 Anti-SLC6A4 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody human
immunofluorescence pricing
SAB1411290 Anti-SLC6A4 antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human, mouse
western blot pricing
SAB2500950 Anti-SLC6A4/5HTT/SERT antibody produced in goat affinity isolated antibody, buffered aqueous solution human
ELISA, western blot pricing
WH0006532M6 Monoclonal Anti-SLC6A4 antibody produced in mouse clone 2A9, purified immunoglobulin, buffered aqueous solution human
ELISA pricing

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
M8750 (+)-Methamphetamine hydrochloride human pricing
M5260 (+)-Methamphetamine hydrochloride solution analytical standard, for drug analysis, 1.0 mg/mL in methanol human pricing
PH017236 (3S,4R)-3-[(1,3-Benzodioxol-5-yloxy)methyl]-4-(4-fluorophenyl)piperidine AldrichCPR human pricing
PH019080 (3S,4R)-3-[(1,3-Benzodioxol-5-yloxy)methyl]-4-(4-fluorophenyl)piperidine hydrochloride AldrichCPR human pricing
SML0474 (S)-Duloxetine hydrochloride ≥98% (HPLC) human pricing
A8404 Amitriptyline hydrochloride ≥98% (TLC), powder human pricing
PHR1384 Amitriptyline hydrochloride Pharmaceutical Secondary Standard; Certified Reference Material human pricing
1029002 Amitriptyline hydrochloride United States Pharmacopeia (USP) Reference Standard human pricing
BP016 Amitriptyline hydrochloride British Pharmacopoeia (BP) Reference Standard human pricing
Y0000563 Amitriptyline hydrochloride European Pharmacopoeia (EP) Reference Standard human pricing
A-923 Amitriptyline hydrochloride solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
A129 Amoxapine human pricing
A-123 Amoxapine 1.0 mg/mL in methanol, certified reference material, Cerilliant® human pricing
PHR1841 Amoxapine Pharmaceutical Secondary Standard; Certified Reference Material human pricing
1031401 Amoxapine United States Pharmacopeia (USP) Reference Standard human pricing
Y0000855 Citalopram for system suitability European Pharmacopoeia (EP) Reference Standard human pricing
C7861 Citalopram hydrobromide ≥98% (HPLC) human pricing
1134233 Citalopram hydrobromide United States Pharmacopeia (USP) Reference Standard human pricing
BP1153 Citalopram hydrobromide British Pharmacopoeia (BP) Reference Standard human pricing
Y0001008 Citalopram hydrobromide European Pharmacopoeia (EP) Reference Standard human pricing
PHR1640 Citalopram Hydrobromide Pharmaceutical Secondary Standard; Certified Reference Material human pricing
C-095 Citalopram hydrobromide solution 1.0 mg/mL in methanol (as free base), ampule of 1 mL, certified reference material, Cerilliant® human pricing
C-057 Citalopram hydrobromide solution 100 μg/mL in methanol (as free base), ampule of 1 mL, certified reference material, Cerilliant® human pricing
C7291 Clomipramine hydrochloride ≥98% (HPLC), powder human pricing
PHR1720 Clomipramine hydrochloride Pharmaceutical Secondary Standard; Certified Reference Material human pricing
1140247 Clomipramine hydrochloride United States Pharmacopeia (USP) Reference Standard human pricing
BP980 Clomipramine hydrochloride British Pharmacopoeia (BP) Reference Standard human pricing
C2360000 Clomipramine hydrochloride for microbiological assay, European Pharmacopoeia (EP) Reference Standard human pricing
C-118 Clomipramine hydrochloride solution 1.0 mg/mL in methanol (as free base), ampule of 1 mL, certified reference material, Cerilliant® human pricing
D7071 Dapoxetine hydrochloride ≥98% (HPLC) human pricing
Y0001454 Duloxetine for system suitability European Pharmacopoeia (EP) Reference Standard human pricing
Y0001453 Duloxetine hydrochloride European Pharmacopoeia (EP) Reference Standard human pricing
1229817 Duloxetine hydrochloride United States Pharmacopeia (USP) Reference Standard human pricing
PHR1865 Duloxetine Hydrochloride Pharmaceutical Secondary Standard; Certified Reference Material human pricing
Y0001797 Escitalopram for system suitability European Pharmacopoeia (EP) Reference Standard human pricing
E4786 Escitalopram oxalate ≥98% (HPLC), powder human pricing
1249406 Escitalopram oxalate United States Pharmacopeia (USP) Reference Standard human pricing
Y0001796 Escitalopram oxalate European Pharmacopoeia (EP) Reference Standard human pricing
PHR1733 Escitalopram Oxalate Pharmaceutical Secondary Standard; Certified Reference Material human pricing
F132 Fluoxetine hydrochloride solid human pricing
1279804 Fluoxetine hydrochloride United States Pharmacopeia (USP) Reference Standard human pricing
F0253000 Fluoxetine hydrochloride European Pharmacopoeia (EP) Reference Standard human pricing
34012 Fluoxetine hydrochloride VETRANAL®, analytical standard human pricing
BP797 Fluoxetine hydrochloride British Pharmacopoeia (BP) Reference Standard human pricing
PHR1394 Fluoxetine Hydrochloride Pharmaceutical Secondary Standard; Certified Reference Material human pricing
F-918 Fluoxetine hydrochloride solution 1.0 mg/mL in methanol (as free base), ampule of 1 mL, certified reference material, Cerilliant® human pricing
Y0000853 Fluvoxamine for system suitability European Pharmacopoeia (EP) Reference Standard human pricing
F2802 Fluvoxamine maleate solid human pricing
F-040 Fluvoxamine maleate 1.0 mg/mL in methanol (as free base), certified reference material, Cerilliant® human pricing
BP600 Fluvoxamine maleate British Pharmacopoeia (BP) Reference Standard human pricing
Y0000854 Fluvoxamine maleate European Pharmacopoeia (EP) Reference Standard human pricing
1285909 Fluvoxamine maleate United States Pharmacopeia (USP) Reference Standard human pricing
PHR1793 Fluvoxamine Maleate Pharmaceutical Secondary Standard; Certified Reference Material human pricing
BP671 Fluvoxamine maleate impurity standard British Pharmacopoeia (BP) Reference Standard human pricing
Y0000893 Imipramine for system suitability European Pharmacopoeia (EP) Reference Standard human pricing
I7379 Imipramine hydrochloride ≥99% (TLC) human pricing
I0899 Imipramine hydrochloride BioXtra, ≥99% (TLC) human pricing
I0100000 Imipramine hydrochloride European Pharmacopoeia (EP) Reference Standard human pricing
BP932 Imipramine hydrochloride British Pharmacopoeia (BP) Reference Standard human pricing
1338007 Imipramine hydrochloride United States Pharmacopeia (USP) Reference Standard human pricing
PHR1797 Imipramine Hydrochloride Pharmaceutical Secondary Standard; Certified Reference Material human pricing
I-902 Imipramine hydrochloride solution 1.0 mg/mL in methanol (as free base), ampule of 1 mL, certified reference material, Cerilliant® human pricing
1375309 Mazindol United States Pharmacopeia (USP) Reference Standard human pricing
1399001 Methamphetamine hydrochloride United States Pharmacopeia (USP) Reference Standard human pricing
N5536 Nefazodone hydrochloride ≥98% (HPLC), solid human pricing
1457902 Nefazodone hydrochloride United States Pharmacopeia (USP) Reference Standard human pricing
N1530 Nomifensine maleate salt human pricing
Y0001296 Nortriptyline for system suitability European Pharmacopoeia (EP) Reference Standard human pricing
N7261 Nortriptyline hydrochloride ≥98% (TLC), powder human pricing
BP269 Nortriptyline hydrochloride British Pharmacopoeia (BP) Reference Standard human pricing
N1280000 Nortriptyline hydrochloride European Pharmacopoeia (EP) Reference Standard human pricing
1474005 Nortriptyline hydrochloride United States Pharmacopeia (USP) Reference Standard human pricing
N-907 Nortriptyline hydrochloride solution 1.0 mg/mL in methanol (as free base), ampule of 1 mL, certified reference material, Cerilliant® human pricing
93867 O-Desmethylvenlafaxine analytical standard human pricing
V-007 O-Desmethylvenlafaxine solution 100 μg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
V-045 O-Desmethylvenlafaxine solution 1.0 mg/mL in methanol, certified reference material, Cerilliant® human pricing
Y0000630 Paroxetine for system suitability European Pharmacopoeia (EP) Reference Standard human pricing
PHR1804 Paroxetine hydrochloride Pharmaceutical Secondary Standard; Certified Reference Material human pricing
1500218 Paroxetine hydrochloride United States Pharmacopeia (USP) Reference Standard human pricing
P9623 Paroxetine hydrochloride hemihydrate ≥98% (HPLC), powder human pricing
BP1024 Paroxetine hydrochloride hemihydrate British Pharmacopoeia (BP) Reference Standard human pricing
Y0000281 Paroxetine hydrochloride hemihydrate European Pharmacopoeia (EP) Reference Standard human pricing
BP746 Paroxetine impurity standard British Pharmacopoeia (BP) Reference Standard human pricing
P1372 Paroxetine maleate salt ≥98% (HPLC), solid human pricing
P-916 Paroxetine maleate solution 1.0 mg/mL in methanol (as free base), ampule of 1 mL, certified reference material, Cerilliant® human pricing
P8813 Protriptyline hydrochloride ≥99% (TLC), powder human pricing
1580002 Protriptyline hydrochloride United States Pharmacopeia (USP) Reference Standard human pricing
P-903 Protriptyline hydrochloride solution 1.0 mg/mL in methanol (as free base), ampule of 1 mL, certified reference material, Cerilliant® human pricing
M-020 S(+)-Methamphetamine solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
Y0000866 Sertraline for peak identification European Pharmacopoeia (EP) Reference Standard human pricing
Y0000867 Sertraline for system suitability European Pharmacopoeia (EP) Reference Standard human pricing
S6319 Sertraline hydrochloride ≥98% (HPLC) human pricing
Y0000828 Sertraline hydrochloride European Pharmacopoeia (EP) Reference Standard human pricing
1612539 Sertraline hydrochloride United States Pharmacopeia (USP) Reference Standard human pricing
BP883 Sertraline hydrochloride British Pharmacopoeia (BP) Reference Standard human pricing
BP897 Sertraline hydrochloride impurity standard British Pharmacopoeia (BP) Reference Standard human pricing
1612517 Sertraline hydrochloride racemic mixture United States Pharmacopeia (USP) Reference Standard human pricing
S-021 Sertraline hydrochloride solution 1.0 mg/mL in methanol (as free base), ampule of 1 mL, certified reference material, Cerilliant® human pricing
S9944 Sibutramine hydrochloride monohydrate ≥98% (HPLC), solid human pricing
S-011 Sibutramine hydrochloride solution 1.0 mg/mL in methanol (as free base), ampule of 1 mL, certified reference material, Cerilliant® human pricing
T6154 Trazodone hydrochloride ≥99% (HPLC), powder human pricing
1673500 Trazodone hydrochloride United States Pharmacopeia (USP) Reference Standard human pricing
BP590 Trazodone hydrochloride British Pharmacopoeia (BP) Reference Standard human pricing
BP591 Trazodone hydrochloride impurity standard British Pharmacopoeia (BP) Reference Standard human pricing
T-030 Trazodone hydrochloride solution 1.0 mg/mL in methanol (as free base), ampule of 1 mL, certified reference material, Cerilliant® human pricing
Y0000588 Venlafaxine for system suitability European Pharmacopoeia (EP) Reference Standard human pricing
V7264 Venlafaxine hydrochloride ≥98% (HPLC), powder human pricing
BP835 Venlafaxine hydrochloride British Pharmacopoeia (BP) Reference Standard human pricing
Y0000587 Venlafaxine hydrochloride European Pharmacopoeia (EP) Reference Standard human pricing
1711268 Venlafaxine hydrochloride United States Pharmacopeia (USP) Reference Standard human pricing
PHR1736 Venlafaxine Hydrochloride Pharmaceutical Secondary Standard; Certified Reference Material human pricing
V-004 Venlafaxine hydrochloride solution 1.0 mg/mL in methanol (as free base), ampule of 1 mL, certified reference material, Cerilliant® human pricing
BP836 Venlafaxine impurity standard British Pharmacopoeia (BP) Reference Standard human pricing
SML1098 Vilazodone hydrochloride ≥98% (HPLC) human pricing
V-076 Vilazodone hydrochloride solution 1 mg/mL (Methanol:DMSO (90:10) (v/v)), certified reference material, ampule of 1 mL, Cerilliant® human pricing
C8912 Cocaine free base human, mouse, rat pricing

Small Molecule - Ligand

Product # Description Species Add to Cart
 
M3157 Minaprine dihydrochloride analytical standard human, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001045 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001045 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001045 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010484 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010484 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010484 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU023771 MISSION® esiRNA targeting human SLC6A4 human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001045 Rosetta Predictions human pricing
NM_013034 Rosetta Predictions rat pricing
NM_010484 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001045 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00217013 predicted 1088
2 SASI_Hs01_00217014 predicted 730
3 SASI_Hs01_00217015 predicted 2178
4 SASI_Hs01_00217016 predicted 1835
5 SASI_Hs01_00217017 predicted 2068
6 SASI_Hs02_00311422 predicted 744
7 SASI_Hs01_00217018 predicted 617
8 SASI_Hs01_00217019 predicted 1231
9 SASI_Hs01_00217020 predicted 332
10 SASI_Hs01_00217021 predicted 405
11 SASI_Hs01_00217022 predicted 719
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013034 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00260730 predicted 228
2 SASI_Rn02_00260731 predicted 1915
3 SASI_Rn02_00260732 predicted 733
4 SASI_Rn02_00260733 predicted 1639
5 SASI_Rn02_00260734 predicted 889
6 SASI_Rn02_00260735 predicted 1976
7 SASI_Rn02_00260736 predicted 1815
8 SASI_Rn02_00260737 predicted 2081
9 SASI_Rn02_00260738 predicted 1873
10 SASI_Rn02_00260739 predicted 1557
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010484 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00132910 predicted 1993
2 SASI_Mm01_00132911 predicted 1903
3 SASI_Mm01_00132912 predicted 816
4 SASI_Mm01_00132913 predicted 1721
5 SASI_Mm01_00132915 predicted 2061
6 SASI_Mm02_00318720 predicted 366
7 SASI_Mm01_00132916 predicted 1050
8 SASI_Mm01_00132917 predicted 209
9 SASI_Mm02_00318721 predicted 635
10 SASI_Mm01_00132918 predicted 1408
11 SASI_Mm01_00132914 predicted 1837
12 SASI_Mm01_00132919 predicted 1572
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001045
SLC6A4 MISSION shRNA Bacterial Glycerol Stock
solute carrier family 6 (neurotransmitter transporter), member 4
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000433497    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001045.4-2820s21c1
Sequence:CCGGACTGTTCATGAATACGTAAACCTCGAGGTTTACGTATTCATGAACAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430015    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001045.4-2861s21c1
Sequence:CCGGTGCTATCTCGCTAGCCATATACTCGAGTATATGGCTAGCGAGATAGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422925    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001045.4-2349s21c1
Sequence:CCGGGGACATTTAAAGAGCGTATTACTCGAGTAATACGCTCTTTAAATGTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001045.2-1930s1c1
Sequence:CCGGCCCTCTGTTTCTCCTGTTCATCTCGAGATGAACAGGAGAAACAGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042888    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001045.2-415s1c1
Sequence:CCGGCGGGCAAATATCCAATGGGTACTCGAGTACCCATTGGATATTTGCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001045.2-335s1c1
Sequence:CCGGGCGTGTGAAGATGGAGAAGATCTCGAGATCTTCTCCATCTTCACACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001045.2-1441s1c1
Sequence:CCGGGCTCGGTTACATGGCTGAGATCTCGAGATCTCAGCCATGTAACCGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042889    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001045.2-2011s1c1
Sequence:CCGGCTGGAGTATCATCTTGGGTTACTCGAGTAACCCAAGATGATACTCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423041    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001045.4-2591s21c1
Sequence:CCGGCAAGGCCTCCAGCCACTTATTCTCGAGAATAAGTGGCTGGAGGCCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001045
SLC6A4 MISSION shRNA shRNA Plasmid DNA
solute carrier family 6 (neurotransmitter transporter), member 4
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000433497    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001045.4-2820s21c1
Sequence:CCGGACTGTTCATGAATACGTAAACCTCGAGGTTTACGTATTCATGAACAGTTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000430015    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001045.4-2861s21c1
Sequence:CCGGTGCTATCTCGCTAGCCATATACTCGAGTATATGGCTAGCGAGATAGCATTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000422925    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001045.4-2349s21c1
Sequence:CCGGGGACATTTAAAGAGCGTATTACTCGAGTAATACGCTCTTTAAATGTCCTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000042892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001045.2-1930s1c1
Sequence:CCGGCCCTCTGTTTCTCCTGTTCATCTCGAGATGAACAGGAGAAACAGAGGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000042888    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001045.2-415s1c1
Sequence:CCGGCGGGCAAATATCCAATGGGTACTCGAGTACCCATTGGATATTTGCCCGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000042890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001045.2-335s1c1
Sequence:CCGGGCGTGTGAAGATGGAGAAGATCTCGAGATCTTCTCCATCTTCACACGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000042891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001045.2-1441s1c1
Sequence:CCGGGCTCGGTTACATGGCTGAGATCTCGAGATCTCAGCCATGTAACCGAGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000042889    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001045.2-2011s1c1
Sequence:CCGGCTGGAGTATCATCTTGGGTTACTCGAGTAACCCAAGATGATACTCCAGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000423041    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001045.4-2591s21c1
Sequence:CCGGCAAGGCCTCCAGCCACTTATTCTCGAGAATAAGTGGCTGGAGGCCTTGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001045
SLC6A4 MISSION shRNA Lentiviral Transduction Particles
solute carrier family 6 (neurotransmitter transporter), member 4
Human
9 Products Total
TRC Number Volume Titer/mL Vector Price Set Price (5+)? Select
TRCN0000433497    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001045.4-2820s21c1
Sequence:CCGGACTGTTCATGAATACGTAAACCTCGAGGTTTACGTATTCATGAACAGTTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430015    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001045.4-2861s21c1
Sequence:CCGGTGCTATCTCGCTAGCCATATACTCGAGTATATGGCTAGCGAGATAGCATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422925    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001045.4-2349s21c1
Sequence:CCGGGGACATTTAAAGAGCGTATTACTCGAGTAATACGCTCTTTAAATGTCCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001045.2-1930s1c1
Sequence:CCGGCCCTCTGTTTCTCCTGTTCATCTCGAGATGAACAGGAGAAACAGAGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042888    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001045.2-415s1c1
Sequence:CCGGCGGGCAAATATCCAATGGGTACTCGAGTACCCATTGGATATTTGCCCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001045.2-335s1c1
Sequence:CCGGGCGTGTGAAGATGGAGAAGATCTCGAGATCTTCTCCATCTTCACACGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001045.2-1441s1c1
Sequence:CCGGGCTCGGTTACATGGCTGAGATCTCGAGATCTCAGCCATGTAACCGAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042889    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001045.2-2011s1c1
Sequence:CCGGCTGGAGTATCATCTTGGGTTACTCGAGTAACCCAAGATGATACTCCAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423041    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001045.4-2591s21c1
Sequence:CCGGCAAGGCCTCCAGCCACTTATTCTCGAGAATAAGTGGCTGGAGGCCTTGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010484
SLC6A4 MISSION shRNA Bacterial Glycerol Stock
solute carrier family 6 (neurotransmitter transporter), member 4
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000219024    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010484.1-2486s21c1
Sequence:GTACCGGGATGTCTTGCTAGCCATATATCTCGAGATATATGGCTAGCAAGACATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234074    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010484.1-2026s21c1
Sequence:CCGGCCTGAAACACCAACGGAAATTCTCGAGAATTTCCGTTGGTGTTTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234073    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010484.1-1993s21c1
Sequence:CCGGACACTTAAGGAGCGCATTATTCTCGAGAATAATGCGCTCCTTAAGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010484.1-1473s1c1
Sequence:CCGGCATGTTAATCACGCTGGGTTTCTCGAGAAACCCAGCGTGATTAACATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010484.1-2024s1c1
Sequence:CCGGCTCCTGAAACACCAACGGAAACTCGAGTTTCCGTTGGTGTTTCAGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070114    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010484.1-219s1c1
Sequence:CCGGGCTGTCAGAGTGTAAGGACAACTCGAGTTGTCCTTACACTCTGACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070115    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010484.1-1949s1c1
Sequence:CCGGGCATCCCTATATACATCATTTCTCGAGAAATGATGTATATAGGGATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234071    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010484.1-697s21c1
Sequence:CCGGTATATCGCCTCCTACTATAACCTCGAGGTTATAGTAGGAGGCGATATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070113    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010484.1-702s1c1
Sequence:CCGGCGCCTCCTACTATAACACCATCTCGAGATGGTGTTATAGTAGGAGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234072    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010484.1-1941s21c1
Sequence:CCGGTGTCATCTGCATCCCTATATACTCGAGTATATAGGGATGCAGATGACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010484
SLC6A4 MISSION shRNA shRNA Plasmid DNA
solute carrier family 6 (neurotransmitter transporter), member 4
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000219024    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010484.1-2486s21c1
Sequence:GTACCGGGATGTCTTGCTAGCCATATATCTCGAGATATATGGCTAGCAAGACATCTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000234074    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010484.1-2026s21c1
Sequence:CCGGCCTGAAACACCAACGGAAATTCTCGAGAATTTCCGTTGGTGTTTCAGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000234073    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010484.1-1993s21c1
Sequence:CCGGACACTTAAGGAGCGCATTATTCTCGAGAATAATGCGCTCCTTAAGTGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000070116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010484.1-1473s1c1
Sequence:CCGGCATGTTAATCACGCTGGGTTTCTCGAGAAACCCAGCGTGATTAACATGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000070117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010484.1-2024s1c1
Sequence:CCGGCTCCTGAAACACCAACGGAAACTCGAGTTTCCGTTGGTGTTTCAGGAGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000070114    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010484.1-219s1c1
Sequence:CCGGGCTGTCAGAGTGTAAGGACAACTCGAGTTGTCCTTACACTCTGACAGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000070115    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010484.1-1949s1c1
Sequence:CCGGGCATCCCTATATACATCATTTCTCGAGAAATGATGTATATAGGGATGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000234071    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010484.1-697s21c1
Sequence:CCGGTATATCGCCTCCTACTATAACCTCGAGGTTATAGTAGGAGGCGATATATTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000070113    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010484.1-702s1c1
Sequence:CCGGCGCCTCCTACTATAACACCATCTCGAGATGGTGTTATAGTAGGAGGCGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000234072    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010484.1-1941s21c1
Sequence:CCGGTGTCATCTGCATCCCTATATACTCGAGTATATAGGGATGCAGATGACATTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010484
SLC6A4 MISSION shRNA Lentiviral Transduction Particles
solute carrier family 6 (neurotransmitter transporter), member 4
Mouse
10 Products Total
TRC Number Volume Titer/mL Vector Price Set Price (5+)? Select
TRCN0000219024    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010484.1-2486s21c1
Sequence:GTACCGGGATGTCTTGCTAGCCATATATCTCGAGATATATGGCTAGCAAGACATCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234074    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010484.1-2026s21c1
Sequence:CCGGCCTGAAACACCAACGGAAATTCTCGAGAATTTCCGTTGGTGTTTCAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234073    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010484.1-1993s21c1
Sequence:CCGGACACTTAAGGAGCGCATTATTCTCGAGAATAATGCGCTCCTTAAGTGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010484.1-1473s1c1
Sequence:CCGGCATGTTAATCACGCTGGGTTTCTCGAGAAACCCAGCGTGATTAACATGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010484.1-2024s1c1
Sequence:CCGGCTCCTGAAACACCAACGGAAACTCGAGTTTCCGTTGGTGTTTCAGGAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070114    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010484.1-219s1c1
Sequence:CCGGGCTGTCAGAGTGTAAGGACAACTCGAGTTGTCCTTACACTCTGACAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070115    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010484.1-1949s1c1
Sequence:CCGGGCATCCCTATATACATCATTTCTCGAGAAATGATGTATATAGGGATGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234071    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010484.1-697s21c1
Sequence:CCGGTATATCGCCTCCTACTATAACCTCGAGGTTATAGTAGGAGGCGATATATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070113    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010484.1-702s1c1
Sequence:CCGGCGCCTCCTACTATAACACCATCTCGAGATGGTGTTATAGTAGGAGGCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234072    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010484.1-1941s21c1
Sequence:CCGGTGTCATCTGCATCCCTATATACTCGAGTATATAGGGATGCAGATGACATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)