EMAIL THIS PAGE TO A FRIEND

SLC6A4

solute carrier family 6 (neurotransmitter transporter), member 4

99 Gene Product Result for
Synonyms: 5-HTT 5-HTTLPR 5HTT HTT OCD1 SERT SERT1 hSERT
UniProtKB ID: P31645, Q5EE02
Gene ID:
Human(6532) Summary: This gene encodes an integral membrane protein that transports the neurotransmitter serotonin from synaptic spaces into presynaptic neurons. The encoded protein terminates the action of serotonin and recycles it in a sodium-dependent manner. This protein is a target of psychomotor stimulants, such as amphetamines and cocaine, and is a member of the sodium:neurotransmitter symporter family. A repeat length polymorphism in the promoter of this gene has been shown to affect the rate of serotonin uptake and may play a role in sudden infant death syndrome, aggressive behavior in Alzheimer disease patients, and depression-susceptibility in people experiencing emotional trauma. [provided by RefSeq, Jul 2008]
Mouse(15567) solute carrier family 6 (neurotransmitter transporter, serotonin), member 4
Rat(25553) solute carrier family 6 (neurotransmitter transporter), member 4
domestic guinea pig(100135619) solute carrier family 6 (neurotransmitter transporter, serotonin), member 4
naked mole-rat(101705584) solute carrier family 6 (neurotransmitter transporter, serotonin), member 4
Domestic Rabbit(100340600) solute carrier family 6 (neurotransmitter transporter, serotonin), member 4
Domestic Rabbit(100351801) solute carrier family 6 (neurotransmitter transporter, serotonin), member 4
cow(282365) solute carrier family 6 (neurotransmitter transporter, serotonin), member 4
chicken(404747) solute carrier family 6 (neurotransmitter transporter, serotonin), member 4
Horse(100053721) solute carrier family 6 (neurotransmitter transporter, serotonin), member 4
domestic cat(101091163) solute carrier family 6 (neurotransmitter transporter, serotonin), member 4
dog(491184) solute carrier family 6 (neurotransmitter transporter, serotonin), member 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
C8912 Cocaine free base human, mouse, rat pricing

Small Molecule - Ligand

Product # Description Species Add to Cart
 
M3157 Minaprine dihydrochloride analytical standard human, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001045 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001045 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001045 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010484 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010484 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010484 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU023771 MISSION® esiRNA esiRNA human SLC6A4 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001045 Rosetta Predictions human pricing
NM_013034 Rosetta Predictions rat pricing
NM_010484 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001045 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00217013 predicted 1088
2 SASI_Hs01_00217014 predicted 730
3 SASI_Hs01_00217015 predicted 2178
4 SASI_Hs01_00217016 predicted 1835
5 SASI_Hs01_00217017 predicted 2068
6 SASI_Hs02_00311422 predicted 744
7 SASI_Hs01_00217018 predicted 617
8 SASI_Hs01_00217019 predicted 1231
9 SASI_Hs01_00217020 predicted 332
10 SASI_Hs01_00217021 predicted 405
11 SASI_Hs01_00217022 predicted 719
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013034 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00260730 predicted 228
2 SASI_Rn02_00260731 predicted 1915
3 SASI_Rn02_00260732 predicted 733
4 SASI_Rn02_00260733 predicted 1639
5 SASI_Rn02_00260734 predicted 889
6 SASI_Rn02_00260735 predicted 1976
7 SASI_Rn02_00260736 predicted 1815
8 SASI_Rn02_00260737 predicted 2081
9 SASI_Rn02_00260738 predicted 1873
10 SASI_Rn02_00260739 predicted 1557
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010484 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00132910 predicted 1993
2 SASI_Mm01_00132911 predicted 1903
3 SASI_Mm01_00132912 predicted 816
4 SASI_Mm01_00132913 predicted 1721
5 SASI_Mm01_00132915 predicted 2061
6 SASI_Mm02_00318720 predicted 366
7 SASI_Mm01_00132916 predicted 1050
8 SASI_Mm01_00132917 predicted 209
9 SASI_Mm02_00318721 predicted 635
10 SASI_Mm01_00132918 predicted 1408
11 SASI_Mm01_00132914 predicted 1837
12 SASI_Mm01_00132919 predicted 1572
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001045
SLC6A4 MISSION shRNA Bacterial Glycerol Stock
solute carrier family 6 (neurotransmitter transporter), member 4
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000433497    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001045.4-2820s21c1
Sequence:CCGGACTGTTCATGAATACGTAAACCTCGAGGTTTACGTATTCATGAACAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430015    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001045.4-2861s21c1
Sequence:CCGGTGCTATCTCGCTAGCCATATACTCGAGTATATGGCTAGCGAGATAGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422925    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001045.4-2349s21c1
Sequence:CCGGGGACATTTAAAGAGCGTATTACTCGAGTAATACGCTCTTTAAATGTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001045.2-1930s1c1
Sequence:CCGGCCCTCTGTTTCTCCTGTTCATCTCGAGATGAACAGGAGAAACAGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042888    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001045.2-415s1c1
Sequence:CCGGCGGGCAAATATCCAATGGGTACTCGAGTACCCATTGGATATTTGCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001045.2-335s1c1
Sequence:CCGGGCGTGTGAAGATGGAGAAGATCTCGAGATCTTCTCCATCTTCACACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001045.2-1441s1c1
Sequence:CCGGGCTCGGTTACATGGCTGAGATCTCGAGATCTCAGCCATGTAACCGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042889    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001045.2-2011s1c1
Sequence:CCGGCTGGAGTATCATCTTGGGTTACTCGAGTAACCCAAGATGATACTCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423041    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001045.4-2591s21c1
Sequence:CCGGCAAGGCCTCCAGCCACTTATTCTCGAGAATAAGTGGCTGGAGGCCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001045
SLC6A4 MISSION shRNA shRNA Plasmid DNA
solute carrier family 6 (neurotransmitter transporter), member 4
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000433497    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001045.4-2820s21c1
Sequence:CCGGACTGTTCATGAATACGTAAACCTCGAGGTTTACGTATTCATGAACAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430015    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001045.4-2861s21c1
Sequence:CCGGTGCTATCTCGCTAGCCATATACTCGAGTATATGGCTAGCGAGATAGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422925    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001045.4-2349s21c1
Sequence:CCGGGGACATTTAAAGAGCGTATTACTCGAGTAATACGCTCTTTAAATGTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001045.2-1930s1c1
Sequence:CCGGCCCTCTGTTTCTCCTGTTCATCTCGAGATGAACAGGAGAAACAGAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042888    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001045.2-415s1c1
Sequence:CCGGCGGGCAAATATCCAATGGGTACTCGAGTACCCATTGGATATTTGCCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001045.2-335s1c1
Sequence:CCGGGCGTGTGAAGATGGAGAAGATCTCGAGATCTTCTCCATCTTCACACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001045.2-1441s1c1
Sequence:CCGGGCTCGGTTACATGGCTGAGATCTCGAGATCTCAGCCATGTAACCGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042889    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001045.2-2011s1c1
Sequence:CCGGCTGGAGTATCATCTTGGGTTACTCGAGTAACCCAAGATGATACTCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423041    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001045.4-2591s21c1
Sequence:CCGGCAAGGCCTCCAGCCACTTATTCTCGAGAATAAGTGGCTGGAGGCCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001045
SLC6A4 MISSION shRNA Lentiviral Transduction Particles
solute carrier family 6 (neurotransmitter transporter), member 4
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000433497    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001045.4-2820s21c1
Sequence:CCGGACTGTTCATGAATACGTAAACCTCGAGGTTTACGTATTCATGAACAGTTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430015    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001045.4-2861s21c1
Sequence:CCGGTGCTATCTCGCTAGCCATATACTCGAGTATATGGCTAGCGAGATAGCATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422925    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001045.4-2349s21c1
Sequence:CCGGGGACATTTAAAGAGCGTATTACTCGAGTAATACGCTCTTTAAATGTCCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001045.2-1930s1c1
Sequence:CCGGCCCTCTGTTTCTCCTGTTCATCTCGAGATGAACAGGAGAAACAGAGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042888    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001045.2-415s1c1
Sequence:CCGGCGGGCAAATATCCAATGGGTACTCGAGTACCCATTGGATATTTGCCCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001045.2-335s1c1
Sequence:CCGGGCGTGTGAAGATGGAGAAGATCTCGAGATCTTCTCCATCTTCACACGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001045.2-1441s1c1
Sequence:CCGGGCTCGGTTACATGGCTGAGATCTCGAGATCTCAGCCATGTAACCGAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042889    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001045.2-2011s1c1
Sequence:CCGGCTGGAGTATCATCTTGGGTTACTCGAGTAACCCAAGATGATACTCCAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423041    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001045.4-2591s21c1
Sequence:CCGGCAAGGCCTCCAGCCACTTATTCTCGAGAATAAGTGGCTGGAGGCCTTGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010484
SLC6A4 MISSION shRNA Bacterial Glycerol Stock
solute carrier family 6 (neurotransmitter transporter), member 4
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000219024    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010484.1-2486s21c1
Sequence:GTACCGGGATGTCTTGCTAGCCATATATCTCGAGATATATGGCTAGCAAGACATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234074    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010484.1-2026s21c1
Sequence:CCGGCCTGAAACACCAACGGAAATTCTCGAGAATTTCCGTTGGTGTTTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234073    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010484.1-1993s21c1
Sequence:CCGGACACTTAAGGAGCGCATTATTCTCGAGAATAATGCGCTCCTTAAGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010484.1-1473s1c1
Sequence:CCGGCATGTTAATCACGCTGGGTTTCTCGAGAAACCCAGCGTGATTAACATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010484.1-2024s1c1
Sequence:CCGGCTCCTGAAACACCAACGGAAACTCGAGTTTCCGTTGGTGTTTCAGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070114    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010484.1-219s1c1
Sequence:CCGGGCTGTCAGAGTGTAAGGACAACTCGAGTTGTCCTTACACTCTGACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070115    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010484.1-1949s1c1
Sequence:CCGGGCATCCCTATATACATCATTTCTCGAGAAATGATGTATATAGGGATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234071    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010484.1-697s21c1
Sequence:CCGGTATATCGCCTCCTACTATAACCTCGAGGTTATAGTAGGAGGCGATATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070113    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010484.1-702s1c1
Sequence:CCGGCGCCTCCTACTATAACACCATCTCGAGATGGTGTTATAGTAGGAGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234072    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010484.1-1941s21c1
Sequence:CCGGTGTCATCTGCATCCCTATATACTCGAGTATATAGGGATGCAGATGACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010484
SLC6A4 MISSION shRNA shRNA Plasmid DNA
solute carrier family 6 (neurotransmitter transporter), member 4
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000219024    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010484.1-2486s21c1
Sequence:GTACCGGGATGTCTTGCTAGCCATATATCTCGAGATATATGGCTAGCAAGACATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234074    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010484.1-2026s21c1
Sequence:CCGGCCTGAAACACCAACGGAAATTCTCGAGAATTTCCGTTGGTGTTTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234073    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010484.1-1993s21c1
Sequence:CCGGACACTTAAGGAGCGCATTATTCTCGAGAATAATGCGCTCCTTAAGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010484.1-1473s1c1
Sequence:CCGGCATGTTAATCACGCTGGGTTTCTCGAGAAACCCAGCGTGATTAACATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010484.1-2024s1c1
Sequence:CCGGCTCCTGAAACACCAACGGAAACTCGAGTTTCCGTTGGTGTTTCAGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070114    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010484.1-219s1c1
Sequence:CCGGGCTGTCAGAGTGTAAGGACAACTCGAGTTGTCCTTACACTCTGACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070115    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010484.1-1949s1c1
Sequence:CCGGGCATCCCTATATACATCATTTCTCGAGAAATGATGTATATAGGGATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234071    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010484.1-697s21c1
Sequence:CCGGTATATCGCCTCCTACTATAACCTCGAGGTTATAGTAGGAGGCGATATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070113    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010484.1-702s1c1
Sequence:CCGGCGCCTCCTACTATAACACCATCTCGAGATGGTGTTATAGTAGGAGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234072    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010484.1-1941s21c1
Sequence:CCGGTGTCATCTGCATCCCTATATACTCGAGTATATAGGGATGCAGATGACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010484
SLC6A4 MISSION shRNA Lentiviral Transduction Particles
solute carrier family 6 (neurotransmitter transporter), member 4
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000219024    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010484.1-2486s21c1
Sequence:GTACCGGGATGTCTTGCTAGCCATATATCTCGAGATATATGGCTAGCAAGACATCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234074    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010484.1-2026s21c1
Sequence:CCGGCCTGAAACACCAACGGAAATTCTCGAGAATTTCCGTTGGTGTTTCAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234073    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010484.1-1993s21c1
Sequence:CCGGACACTTAAGGAGCGCATTATTCTCGAGAATAATGCGCTCCTTAAGTGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010484.1-1473s1c1
Sequence:CCGGCATGTTAATCACGCTGGGTTTCTCGAGAAACCCAGCGTGATTAACATGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010484.1-2024s1c1
Sequence:CCGGCTCCTGAAACACCAACGGAAACTCGAGTTTCCGTTGGTGTTTCAGGAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070114    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010484.1-219s1c1
Sequence:CCGGGCTGTCAGAGTGTAAGGACAACTCGAGTTGTCCTTACACTCTGACAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070115    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010484.1-1949s1c1
Sequence:CCGGGCATCCCTATATACATCATTTCTCGAGAAATGATGTATATAGGGATGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234071    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010484.1-697s21c1
Sequence:CCGGTATATCGCCTCCTACTATAACCTCGAGGTTATAGTAGGAGGCGATATATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070113    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010484.1-702s1c1
Sequence:CCGGCGCCTCCTACTATAACACCATCTCGAGATGGTGTTATAGTAGGAGGCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234072    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010484.1-1941s21c1
Sequence:CCGGTGTCATCTGCATCCCTATATACTCGAGTATATAGGGATGCAGATGACATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)