EMAIL THIS PAGE TO A FRIEND

SLC6A6

solute carrier family 6 (neurotransmitter transporter), member 6

222 Gene Product Result for
Synonyms: TAUT
UniProtKB ID: P31641, B2RNU7, Q9BRI2, Q9BXB0
Gene ID:
Human(6533) Summary: This gene encodes a multi-pass membrane protein that is a member of a family of sodium and chloride-ion dependent transporters. The encoded protein transports taurine and beta-alanine. There is a pseudogene for this gene on chromosome 21. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2013]
Mouse(21366) solute carrier family 6 (neurotransmitter transporter, taurine), member 6
Rat(29464) solute carrier family 6 (neurotransmitter transporter), member 6
domestic guinea pig(100723058) solute carrier family 6 (neurotransmitter transporter, taurine), member 6
naked mole-rat(101705398) solute carrier family 6 (neurotransmitter transporter, taurine), member 6
Domestic Rabbit(100346970) solute carrier family 6 (neurotransmitter transporter, taurine), member 6
cow(282366) solute carrier family 6 (neurotransmitter transporter, taurine), member 6
sheep(101105033) solute carrier family 6 (neurotransmitter transporter, taurine), member 6
chicken(416041) solute carrier family 6 (neurotransmitter transporter, taurine), member 6
dog(404000) solute carrier family 6 (neurotransmitter transporter, taurine), member 6
domestic cat(101101373) solute carrier family 6 (neurotransmitter transporter, taurine), member 6
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003043 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003043 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003043 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009320 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009320 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009320 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003043 Rosetta Predictions human pricing
NM_017206 Rosetta Predictions rat pricing
NM_009320 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003043 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00093118 predicted 415
2 SASI_Hs01_00093119 predicted 659
3 SASI_Hs01_00093120 predicted 1231
4 SASI_Hs01_00093121 predicted 1703
5 SASI_Hs01_00093122 predicted 1023
6 SASI_Hs01_00093123 predicted 676
7 SASI_Hs01_00093124 predicted 1673
8 SASI_Hs01_00093125 predicted 1738
9 SASI_Hs01_00093126 predicted 463
10 SASI_Hs02_00334955 predicted 837
11 SASI_Hs01_00093127 predicted 1120
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017206 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00081925 predicted 1564
2 SASI_Rn01_00081926 predicted 865
3 SASI_Rn01_00081927 predicted 1843
4 SASI_Rn01_00081928 predicted 795
5 SASI_Rn01_00081929 predicted 1062
6 SASI_Rn01_00081930 predicted 351
7 SASI_Rn01_00081931 predicted 1395
8 SASI_Rn01_00081933 predicted 1399
9 SASI_Rn01_00081934 predicted 1581
10 SASI_Rn02_00261566 predicted 1483
11 SASI_Rn01_00081932 predicted 1095
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009320 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00105862 predicted 1708
2 SASI_Mm01_00105863 predicted 712
3 SASI_Mm01_00105864 predicted 1624
4 SASI_Mm01_00105865 predicted 940
5 SASI_Mm01_00105866 predicted 1671
6 SASI_Mm01_00105867 predicted 1708
7 SASI_Mm01_00105868 predicted 1197
8 SASI_Mm01_00105869 predicted 1082
9 SASI_Mm01_00105870 predicted 647
10 SASI_Mm01_00105871 predicted 1501
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003043
VALIDATED
SLC6A6 MISSION shRNA Bacterial Glycerol Stock
solute carrier family 6 (neurotransmitter transporter), member 6
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000296781    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003043.3-2189s21c1
Sequence:CCGGTCCTGCTGTTTACTAACATTACTCGAGTAATGTTAGTAAACAGCAGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038409    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003043.1-1458s1c1
Sequence:CCGGCCTGGATATATGGAGGTGATACTCGAGTATCACCTCCATATATCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038412    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_003043.1-960s1c1
Sequence:CCGGGCTACAACAAGTACAAGTATACTCGAGTATACTTGTACTTGTTGTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038410    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_003043.1-703s1c1
Sequence:CCGGGCTAGTGTGTTTCTTCTGCATCTCGAGATGCAGAAGAAACACACTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038411    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003043.1-1852s1c1
Sequence:CCGGCCACATCATTGTGGAGACCATCTCGAGATGGTCTCCACAATGATGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038413    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_003043.1-754s1c1
Sequence:CCGGCGTCTACTTCACAGCCACTTTCTCGAGAAAGTGGCTGTGAAGTAGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307272    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003043.3-1236s21c1
Sequence:CCGGGCTACAACAAGTACAAGTATACTCGAGTATACTTGTACTTGTTGTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296783    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003043.3-526s21c1
Sequence:CCGGTGCGTTTCTCATACCGTATTTCTCGAGAAATACGGTATGAGAAACGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296782    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003043.3-664s21c1
Sequence:CCGGCGGCTATGCCTCCGTTGTAATCTCGAGATTACAACGGAGGCATAGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003043
VALIDATED
SLC6A6 MISSION shRNA shRNA Plasmid DNA
solute carrier family 6 (neurotransmitter transporter), member 6
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000296781    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003043.3-2189s21c1
Sequence:CCGGTCCTGCTGTTTACTAACATTACTCGAGTAATGTTAGTAAACAGCAGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000038409    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003043.1-1458s1c1
Sequence:CCGGCCTGGATATATGGAGGTGATACTCGAGTATCACCTCCATATATCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000038412    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_003043.1-960s1c1
Sequence:CCGGGCTACAACAAGTACAAGTATACTCGAGTATACTTGTACTTGTTGTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000038410    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_003043.1-703s1c1
Sequence:CCGGGCTAGTGTGTTTCTTCTGCATCTCGAGATGCAGAAGAAACACACTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000038411    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003043.1-1852s1c1
Sequence:CCGGCCACATCATTGTGGAGACCATCTCGAGATGGTCTCCACAATGATGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000038413    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_003043.1-754s1c1
Sequence:CCGGCGTCTACTTCACAGCCACTTTCTCGAGAAAGTGGCTGTGAAGTAGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000307272    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003043.3-1236s21c1
Sequence:CCGGGCTACAACAAGTACAAGTATACTCGAGTATACTTGTACTTGTTGTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296783    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003043.3-526s21c1
Sequence:CCGGTGCGTTTCTCATACCGTATTTCTCGAGAAATACGGTATGAGAAACGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296782    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003043.3-664s21c1
Sequence:CCGGCGGCTATGCCTCCGTTGTAATCTCGAGATTACAACGGAGGCATAGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003043
VALIDATED
SLC6A6 MISSION shRNA Lentiviral Transduction Particles
solute carrier family 6 (neurotransmitter transporter), member 6
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000296781    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003043.3-2189s21c1
Sequence:CCGGTCCTGCTGTTTACTAACATTACTCGAGTAATGTTAGTAAACAGCAGGATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000038409    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003043.1-1458s1c1
Sequence:CCGGCCTGGATATATGGAGGTGATACTCGAGTATCACCTCCATATATCCAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000038412    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_003043.1-960s1c1
Sequence:CCGGGCTACAACAAGTACAAGTATACTCGAGTATACTTGTACTTGTTGTAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000038410    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_003043.1-703s1c1
Sequence:CCGGGCTAGTGTGTTTCTTCTGCATCTCGAGATGCAGAAGAAACACACTAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000038411    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003043.1-1852s1c1
Sequence:CCGGCCACATCATTGTGGAGACCATCTCGAGATGGTCTCCACAATGATGTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000038413    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_003043.1-754s1c1
Sequence:CCGGCGTCTACTTCACAGCCACTTTCTCGAGAAAGTGGCTGTGAAGTAGACGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000307272    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003043.3-1236s21c1
Sequence:CCGGGCTACAACAAGTACAAGTATACTCGAGTATACTTGTACTTGTTGTAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296783    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003043.3-526s21c1
Sequence:CCGGTGCGTTTCTCATACCGTATTTCTCGAGAAATACGGTATGAGAAACGCATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296782    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003043.3-664s21c1
Sequence:CCGGCGGCTATGCCTCCGTTGTAATCTCGAGATTACAACGGAGGCATAGCCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009320
VALIDATED
SLC6A6 MISSION shRNA Bacterial Glycerol Stock
solute carrier family 6 (neurotransmitter transporter), member 6
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000271729    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009320.3-3849s21c1
Sequence:CCGGTTCGTTCAACGGAACCTTAAACTCGAGTTTAAGGTTCCGTTGAACGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000079838    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009320.3-2774s1c1
Sequence:CCGGGCCAACAAGAAAGATGCCAAACTCGAGTTTGGCATCTTTCTTGTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000079840    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009320.3-1145s1c1
Sequence:CCGGCGACGCTGGAACTCAGATATTCTCGAGAATATCTGAGTTCCAGCGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000079842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009320.3-1856s1c1
Sequence:CCGGCCTGACCTACAACAAAGTGTACTCGAGTACACTTTGTTGTAGGTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000079841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009320.3-1708s1c1
Sequence:CCGGCCTGGATATATGGCGGTGATACTCGAGTATCACCGCCATATATCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000079839    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009320.3-1988s1c1
Sequence:CCGGCGTGAGAATCAAATACCTGATCTCGAGATCAGGTATTTGATTCTCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271727    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009320.3-1210s21c1
Sequence:CCGGGCTATAACAAGTACAAGTATACTCGAGTATACTTGTACTTGTTATAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271728    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009320.3-640s21c1
Sequence:CCGGGCTACGCATCCATCGTCATTGCTCGAGCAATGACGATGGATGCGTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271667    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009320.3-400s21c1
Sequence:CCGGGGTCCAGCAAGATCGACTTTGCTCGAGCAAAGTCGATCTTGCTGGACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271666    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009320.3-500s21c1
Sequence:CCGGTGCGTTCCTCATACCGTATTTCTCGAGAAATACGGTATGAGGAACGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009320
VALIDATED
SLC6A6 MISSION shRNA shRNA Plasmid DNA
solute carrier family 6 (neurotransmitter transporter), member 6
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000271729    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009320.3-3849s21c1
Sequence:CCGGTTCGTTCAACGGAACCTTAAACTCGAGTTTAAGGTTCCGTTGAACGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000079838    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009320.3-2774s1c1
Sequence:CCGGGCCAACAAGAAAGATGCCAAACTCGAGTTTGGCATCTTTCTTGTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000079840    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009320.3-1145s1c1
Sequence:CCGGCGACGCTGGAACTCAGATATTCTCGAGAATATCTGAGTTCCAGCGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000079842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009320.3-1856s1c1
Sequence:CCGGCCTGACCTACAACAAAGTGTACTCGAGTACACTTTGTTGTAGGTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000079841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009320.3-1708s1c1
Sequence:CCGGCCTGGATATATGGCGGTGATACTCGAGTATCACCGCCATATATCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000079839    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009320.3-1988s1c1
Sequence:CCGGCGTGAGAATCAAATACCTGATCTCGAGATCAGGTATTTGATTCTCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000271727    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009320.3-1210s21c1
Sequence:CCGGGCTATAACAAGTACAAGTATACTCGAGTATACTTGTACTTGTTATAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000271728    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009320.3-640s21c1
Sequence:CCGGGCTACGCATCCATCGTCATTGCTCGAGCAATGACGATGGATGCGTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000271667    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009320.3-400s21c1
Sequence:CCGGGGTCCAGCAAGATCGACTTTGCTCGAGCAAAGTCGATCTTGCTGGACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000271666    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009320.3-500s21c1
Sequence:CCGGTGCGTTCCTCATACCGTATTTCTCGAGAAATACGGTATGAGGAACGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009320
VALIDATED
SLC6A6 MISSION shRNA Lentiviral Transduction Particles
solute carrier family 6 (neurotransmitter transporter), member 6
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000271729    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009320.3-3849s21c1
Sequence:CCGGTTCGTTCAACGGAACCTTAAACTCGAGTTTAAGGTTCCGTTGAACGAATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000079838    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009320.3-2774s1c1
Sequence:CCGGGCCAACAAGAAAGATGCCAAACTCGAGTTTGGCATCTTTCTTGTTGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000079840    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009320.3-1145s1c1
Sequence:CCGGCGACGCTGGAACTCAGATATTCTCGAGAATATCTGAGTTCCAGCGTCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000079842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009320.3-1856s1c1
Sequence:CCGGCCTGACCTACAACAAAGTGTACTCGAGTACACTTTGTTGTAGGTCAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000079841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009320.3-1708s1c1
Sequence:CCGGCCTGGATATATGGCGGTGATACTCGAGTATCACCGCCATATATCCAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000079839    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009320.3-1988s1c1
Sequence:CCGGCGTGAGAATCAAATACCTGATCTCGAGATCAGGTATTTGATTCTCACGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000271727    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009320.3-1210s21c1
Sequence:CCGGGCTATAACAAGTACAAGTATACTCGAGTATACTTGTACTTGTTATAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000271728    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009320.3-640s21c1
Sequence:CCGGGCTACGCATCCATCGTCATTGCTCGAGCAATGACGATGGATGCGTAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000271667    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009320.3-400s21c1
Sequence:CCGGGGTCCAGCAAGATCGACTTTGCTCGAGCAAAGTCGATCTTGCTGGACCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000271666    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009320.3-500s21c1
Sequence:CCGGTGCGTTCCTCATACCGTATTTCTCGAGAAATACGGTATGAGGAACGCATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)