EMAIL THIS PAGE TO A FRIEND

SLC6A7

solute carrier family 6 (neurotransmitter transporter), member 7

37 Gene Product Result for
Synonyms: PROT
UniProtKB ID: Q99884, Q0VG81, Q52LU6
Gene ID:
Human(6534) Summary: This gene is a member of the gamma-aminobutyric acid (GABA) neurotransmitter gene family and encodes a high-affinity mammalian brain L-proline transporter protein. This transporter protein differs from other sodium-dependent plasma membrane carriers by its pharmacological specificity, kinetic properties, and ionic requirements. [provided by RefSeq, Jul 2008]
Mouse(240332) solute carrier family 6 (neurotransmitter transporter, L-proline), member 7
Rat(117100) solute carrier family 6 (neurotransmitter transporter), member 7
chicken(416277) solute carrier family 6 (neurotransmitter transporter, L-proline), member 7
dog(489187) solute carrier family 6 (neurotransmitter transporter, L-proline), member 7
domestic cat(101086454) solute carrier family 6 (neurotransmitter transporter, L-proline), member 7
cow(539786) solute carrier family 6 (neurotransmitter transporter, L-proline), member 7
sheep(101123296) solute carrier family 6 (neurotransmitter transporter, L-proline), member 7
naked mole-rat(101721872) solute carrier family 6 (neurotransmitter transporter, L-proline), member 7
domestic guinea pig(100726784) solute carrier family 6 (neurotransmitter transporter, L-proline), member 7
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014228 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014228 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014228 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_201353 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_201353 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_201353 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU144681 MISSION® esiRNA targeting human SLC6A7 human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014228 Rosetta Predictions human pricing
NM_053996 Rosetta Predictions rat pricing
NM_201353 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014228 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00078198 predicted 1842
2 SASI_Hs01_00078199 predicted 1617
3 SASI_Hs01_00078200 predicted 1708
4 SASI_Hs01_00078201 predicted 1550
5 SASI_Hs01_00078202 predicted 1599
6 SASI_Hs02_00345256 predicted 1303
7 SASI_Hs01_00078203 predicted 1299
8 SASI_Hs01_00078204 predicted 1586
9 SASI_Hs01_00078205 predicted 553
10 SASI_Hs01_00078206 predicted 1213
11 SASI_Hs01_00078207 predicted 2012
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053996 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00031193 predicted 661
2 SASI_Rn01_00031194 predicted 1936
3 SASI_Rn01_00031195 predicted 711
4 SASI_Rn01_00031196 predicted 1373
5 SASI_Rn01_00031197 predicted 1456
6 SASI_Rn01_00031198 predicted 1329
7 SASI_Rn02_00266993 predicted 1607
8 SASI_Rn01_00031200 predicted 928
9 SASI_Rn01_00031202 predicted 472
10 SASI_Rn02_00266994 predicted 232
11 SASI_Rn01_00031199 predicted 2172
12 SASI_Rn01_00031201 predicted 1722
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_201353 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00096634 predicted 1823
2 SASI_Mm01_00096635 predicted 1755
3 SASI_Mm01_00096636 predicted 1421
4 SASI_Mm01_00096637 predicted 819
5 SASI_Mm01_00096638 predicted 1838
6 SASI_Mm01_00096639 predicted 1313
7 SASI_Mm01_00096640 predicted 1121
8 SASI_Mm01_00096642 predicted 1460
9 SASI_Mm01_00096643 predicted 575
10 SASI_Mm02_00351507 predicted 1286
11 SASI_Mm01_00096641 predicted 1644
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014228
SLC6A7 MISSION shRNA Bacterial Glycerol Stock
solute carrier family 6 (neurotransmitter transporter), member 7
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000423682    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014228.3-1312s21c1
Sequence:CCGGCGTTTCACCAGAACATCTATACTCGAGTATAGATGTTCTGGTGAAACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423897    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014228.3-2515s21c1
Sequence:CCGGATCCAACTCAGCCCTACTTTGCTCGAGCAAAGTAGGGCTGAGTTGGATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412494    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014228.3-1555s21c1
Sequence:CCGGTCGGCCTAGATAGCCAGTTTGCTCGAGCAAACTGGCTATCTAGGCCGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008625    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014228.2-2328s1c1
Sequence:CCGGCCCTTCTTAGAAGCCTGCAAACTCGAGTTTGCAGGCTTCTAAGAAGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008629    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014228.2-1604s1c1
Sequence:CCGGGACAGATGAGTTCCCATACTACTCGAGTAGTATGGGAACTCATCTGTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008626    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014228.2-1910s1c1
Sequence:CCGGCCTGGTGTATAGCATCGTCAACTCGAGTTGACGATGCTATACACCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014228.2-1230s1c1
Sequence:CCGGGTGTGGATTGAAGCTGCTCTTCTCGAGAAGAGCAGCTTCAATCCACACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008628    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014228.2-785s1c1
Sequence:CCGGCTACGTGCTCTTCTACCTCTTCTCGAGAAGAGGTAGAAGAGCACGTAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014228
SLC6A7 MISSION shRNA shRNA Plasmid DNA
solute carrier family 6 (neurotransmitter transporter), member 7
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000423682    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014228.3-1312s21c1
Sequence:CCGGCGTTTCACCAGAACATCTATACTCGAGTATAGATGTTCTGGTGAAACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423897    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014228.3-2515s21c1
Sequence:CCGGATCCAACTCAGCCCTACTTTGCTCGAGCAAAGTAGGGCTGAGTTGGATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412494    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014228.3-1555s21c1
Sequence:CCGGTCGGCCTAGATAGCCAGTTTGCTCGAGCAAACTGGCTATCTAGGCCGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008625    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014228.2-2328s1c1
Sequence:CCGGCCCTTCTTAGAAGCCTGCAAACTCGAGTTTGCAGGCTTCTAAGAAGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008629    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014228.2-1604s1c1
Sequence:CCGGGACAGATGAGTTCCCATACTACTCGAGTAGTATGGGAACTCATCTGTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008626    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014228.2-1910s1c1
Sequence:CCGGCCTGGTGTATAGCATCGTCAACTCGAGTTGACGATGCTATACACCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014228.2-1230s1c1
Sequence:CCGGGTGTGGATTGAAGCTGCTCTTCTCGAGAAGAGCAGCTTCAATCCACACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008628    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014228.2-785s1c1
Sequence:CCGGCTACGTGCTCTTCTACCTCTTCTCGAGAAGAGGTAGAAGAGCACGTAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014228
SLC6A7 MISSION shRNA Lentiviral Transduction Particles
solute carrier family 6 (neurotransmitter transporter), member 7
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000423682    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014228.3-1312s21c1
Sequence:CCGGCGTTTCACCAGAACATCTATACTCGAGTATAGATGTTCTGGTGAAACGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000423897    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014228.3-2515s21c1
Sequence:CCGGATCCAACTCAGCCCTACTTTGCTCGAGCAAAGTAGGGCTGAGTTGGATTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000412494    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014228.3-1555s21c1
Sequence:CCGGTCGGCCTAGATAGCCAGTTTGCTCGAGCAAACTGGCTATCTAGGCCGATTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000008625    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014228.2-2328s1c1
Sequence:CCGGCCCTTCTTAGAAGCCTGCAAACTCGAGTTTGCAGGCTTCTAAGAAGGGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000008629    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014228.2-1604s1c1
Sequence:CCGGGACAGATGAGTTCCCATACTACTCGAGTAGTATGGGAACTCATCTGTCTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000008626    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014228.2-1910s1c1
Sequence:CCGGCCTGGTGTATAGCATCGTCAACTCGAGTTGACGATGCTATACACCAGGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000008627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014228.2-1230s1c1
Sequence:CCGGGTGTGGATTGAAGCTGCTCTTCTCGAGAAGAGCAGCTTCAATCCACACTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000008628    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014228.2-785s1c1
Sequence:CCGGCTACGTGCTCTTCTACCTCTTCTCGAGAAGAGGTAGAAGAGCACGTAGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_201353
SLC6A7 MISSION shRNA Bacterial Glycerol Stock
solute carrier family 6 (neurotransmitter transporter), member 7
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000070138    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201353.1-578s1c1
Sequence:CCGGGCCATTTACTACAACATGATTCTCGAGAATCATGTTGTAGTAAATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070139    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201353.1-1027s1c1
Sequence:CCGGCCACCACCTGTTATCTTCAAACTCGAGTTTGAAGATAACAGGTGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201353.1-2000s1c1
Sequence:CCGGCTGATGGTACACATGCGCAAACTCGAGTTTGCGCATGTGTACCATCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201353.1-625s1c1
Sequence:CCGGCGCCTCCCTCACCAGCAATTTCTCGAGAAATTGCTGGTGAGGGAGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070140    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201353.1-1640s1c1
Sequence:CCGGCGAGATATCCACATGATGCTACTCGAGTAGCATCATGTGGATATCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_201353
SLC6A7 MISSION shRNA shRNA Plasmid DNA
solute carrier family 6 (neurotransmitter transporter), member 7
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000070138    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201353.1-578s1c1
Sequence:CCGGGCCATTTACTACAACATGATTCTCGAGAATCATGTTGTAGTAAATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070139    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201353.1-1027s1c1
Sequence:CCGGCCACCACCTGTTATCTTCAAACTCGAGTTTGAAGATAACAGGTGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201353.1-2000s1c1
Sequence:CCGGCTGATGGTACACATGCGCAAACTCGAGTTTGCGCATGTGTACCATCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201353.1-625s1c1
Sequence:CCGGCGCCTCCCTCACCAGCAATTTCTCGAGAAATTGCTGGTGAGGGAGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070140    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201353.1-1640s1c1
Sequence:CCGGCGAGATATCCACATGATGCTACTCGAGTAGCATCATGTGGATATCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_201353
SLC6A7 MISSION shRNA Lentiviral Transduction Particles
solute carrier family 6 (neurotransmitter transporter), member 7
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000070138    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201353.1-578s1c1
Sequence:CCGGGCCATTTACTACAACATGATTCTCGAGAATCATGTTGTAGTAAATGGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000070139    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201353.1-1027s1c1
Sequence:CCGGCCACCACCTGTTATCTTCAAACTCGAGTTTGAAGATAACAGGTGGTGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000070141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201353.1-2000s1c1
Sequence:CCGGCTGATGGTACACATGCGCAAACTCGAGTTTGCGCATGTGTACCATCAGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000070142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201353.1-625s1c1
Sequence:CCGGCGCCTCCCTCACCAGCAATTTCTCGAGAAATTGCTGGTGAGGGAGGCGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000070140    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201353.1-1640s1c1
Sequence:CCGGCGAGATATCCACATGATGCTACTCGAGTAGCATCATGTGGATATCTCGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???