EMAIL THIS PAGE TO A FRIEND

SLC6A9

solute carrier family 6 (neurotransmitter transporter, glycine), member 9

89 Gene Product Result for
Synonyms: GLYT1
Gene ID:
Mouse(14664) solute carrier family 6 (neurotransmitter transporter, glycine), member 9
Rat(116509) solute carrier family 6 (neurotransmitter transporter, glycine), member 9
Zebrafish(494490) solute carrier family 6 (neurotransmitter transporter, glycine), member 9
chicken(424576) solute carrier family 6 (neurotransmitter transporter, glycine), member 9
dog(482526) solute carrier family 6 (neurotransmitter transporter, glycine), member 9
Horse(100053016) solute carrier family 6 (neurotransmitter transporter, glycine), member 9
domestic cat(101085226) solute carrier family 6 (neurotransmitter transporter, glycine), member 9
cow(282368) solute carrier family 6 (neurotransmitter transporter, glycine), member 9
cow(515755) solute carrier family 6 (neurotransmitter transporter, glycine), member 9
sheep(101108183) solute carrier family 6 (neurotransmitter transporter, glycine), member 9
Domestic Rabbit(100351167) solute carrier family 6 (neurotransmitter transporter, glycine), member 9
naked mole-rat(101720312) solute carrier family 6 (neurotransmitter transporter, glycine), member 9
domestic guinea pig(100720563) solute carrier family 6 (neurotransmitter transporter, glycine), member 9
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA013977 Anti-SLC6A9 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing
SAB2106585 Anti-SLC6A9 antibody produced in rabbit affinity isolated antibody bovine, guinea pig, human, mouse, horse, rat, dog
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006934 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006934 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006934 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008135 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008135 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008135 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001024845 Rosetta Predictions human pricing
NM_006934 Rosetta Predictions human pricing
NM_201649 Rosetta Predictions human pricing
NM_053818 Rosetta Predictions rat pricing
NM_008135 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024845 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00022781 predicted 591
2 SASI_Hs01_00022782 predicted 1760
3 SASI_Hs01_00022783 predicted 1681
4 SASI_Hs01_00022784 predicted 2430
5 SASI_Hs01_00022785 predicted 1244
6 SASI_Hs01_00022786 predicted 2433
7 SASI_Hs01_00022787 predicted 1286
8 SASI_Hs01_00022788 predicted 999
9 SASI_Hs01_00022789 predicted 1003
10 SASI_Hs01_00022790 predicted 1165
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006934 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00134539 predicted 590
2 SASI_Hs01_00134540 predicted 1772
3 SASI_Hs01_00134541 predicted 1689
4 SASI_Hs01_00134542 predicted 2434
5 SASI_Hs01_00134543 predicted 1250
6 SASI_Hs01_00134544 predicted 2437
7 SASI_Hs01_00134545 predicted 1290
8 SASI_Hs01_00134546 predicted 1010
9 SASI_Hs01_00134547 predicted 1017
10 SASI_Hs01_00134548 predicted 1168
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_201649 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00173086 predicted 758
2 SASI_Hs01_00173087 predicted 1931
3 SASI_Hs01_00173088 predicted 1849
4 SASI_Hs01_00173089 predicted 2592
5 SASI_Hs01_00173090 predicted 1406
6 SASI_Hs01_00173091 predicted 2596
7 SASI_Hs01_00173092 predicted 1448
8 SASI_Hs01_00173093 predicted 1168
9 SASI_Hs01_00173094 predicted 1172
10 SASI_Hs01_00173095 predicted 1333
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053818 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00089863 predicted 1170
2 SASI_Rn01_00089864 predicted 1529
3 SASI_Rn01_00089866 predicted 1756
4 SASI_Rn01_00089867 predicted 993
5 SASI_Rn02_00266648 predicted 946
6 SASI_Rn01_00089868 predicted 932
7 SASI_Rn01_00089869 predicted 1627
8 SASI_Rn01_00089870 predicted 384
9 SASI_Rn02_00266649 predicted 1827
10 SASI_Rn01_00089871 predicted 1173
11 SASI_Rn01_00089865 predicted 839
12 SASI_Rn01_00089872 predicted 677
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008135 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00146153 predicted 1868
2 SASI_Mm01_00146154 predicted 1547
3 SASI_Mm01_00146155 predicted 1274
4 SASI_Mm01_00146156 predicted 1056
5 SASI_Mm01_00146157 predicted 1109
6 SASI_Mm01_00146158 predicted 1068
7 SASI_Mm01_00146159 predicted 1688
8 SASI_Mm01_00146160 predicted 1720
9 SASI_Mm01_00146161 predicted 2146
10 SASI_Mm01_00146162 predicted 1347
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006934
SLC6A9 MISSION shRNA Bacterial Glycerol Stock
solute carrier family 6 (neurotransmitter transporter, glycine), member 9
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000043503    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006934.1-1770s1c1
Sequence:CCGGCCCGCCATCATCTTCTTTATTCTCGAGAATAAAGAAGATGATGGCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006934.1-1688s1c1
Sequence:CCGGCCGGAACTACTTCCAGGACATCTCGAGATGTCCTGGAAGTAGTTCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006934.1-557s1c1
Sequence:CCGGCATGTTCAAAGGAGTGGGCTACTCGAGTAGCCCACTCCTTTGAACATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043504    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006934.1-848s1c1
Sequence:CCGGGCTGAAGCTGTCAGATGACATCTCGAGATGTCATCTGACAGCTTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006934.1-1053s1c1
Sequence:CCGGGACGGCATCATGTACTACCTACTCGAGTAGGTAGTACATGATGCCGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006934
SLC6A9 MISSION shRNA shRNA Plasmid DNA
solute carrier family 6 (neurotransmitter transporter, glycine), member 9
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000043503    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006934.1-1770s1c1
Sequence:CCGGCCCGCCATCATCTTCTTTATTCTCGAGAATAAAGAAGATGATGGCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006934.1-1688s1c1
Sequence:CCGGCCGGAACTACTTCCAGGACATCTCGAGATGTCCTGGAAGTAGTTCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006934.1-557s1c1
Sequence:CCGGCATGTTCAAAGGAGTGGGCTACTCGAGTAGCCCACTCCTTTGAACATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043504    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006934.1-848s1c1
Sequence:CCGGGCTGAAGCTGTCAGATGACATCTCGAGATGTCATCTGACAGCTTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006934.1-1053s1c1
Sequence:CCGGGACGGCATCATGTACTACCTACTCGAGTAGGTAGTACATGATGCCGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006934
SLC6A9 MISSION shRNA Lentiviral Transduction Particles
solute carrier family 6 (neurotransmitter transporter, glycine), member 9
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000043503    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006934.1-1770s1c1
Sequence:CCGGCCCGCCATCATCTTCTTTATTCTCGAGAATAAAGAAGATGATGGCGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006934.1-1688s1c1
Sequence:CCGGCCGGAACTACTTCCAGGACATCTCGAGATGTCCTGGAAGTAGTTCCGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006934.1-557s1c1
Sequence:CCGGCATGTTCAAAGGAGTGGGCTACTCGAGTAGCCCACTCCTTTGAACATGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043504    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006934.1-848s1c1
Sequence:CCGGGCTGAAGCTGTCAGATGACATCTCGAGATGTCATCTGACAGCTTCAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006934.1-1053s1c1
Sequence:CCGGGACGGCATCATGTACTACCTACTCGAGTAGGTAGTACATGATGCCGTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008135
VALIDATED
SLC6A9 MISSION shRNA Bacterial Glycerol Stock
solute carrier family 6 (neurotransmitter transporter, glycine), member 9
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000070338    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008135.1-1209s1c1
Sequence:CCGGCGTCATTATCAGTATCACCAACTCGAGTTGGTGATACTGATAATGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070339    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008135.1-1809s1c1
Sequence:CCGGGCCAATCACCTACAACCACTACTCGAGTAGTGGTTGTAGGTGATTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070341    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008135.1-600s1c1
Sequence:CCGGCATCTACTACAACGTGGTCATCTCGAGATGACCACGTTGTAGTAGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070340    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008135.1-1680s1c1
Sequence:CCGGCCGTAACTACTTCCAGGACATCTCGAGATGTCCTGGAAGTAGTTACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070342    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008135.1-1749s1c1
Sequence:CCGGGCGCTTTGTTTCTCCGGCTATCTCGAGATAGCCGGAGAAACAAAGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008135
VALIDATED
SLC6A9 MISSION shRNA shRNA Plasmid DNA
solute carrier family 6 (neurotransmitter transporter, glycine), member 9
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000070338    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008135.1-1209s1c1
Sequence:CCGGCGTCATTATCAGTATCACCAACTCGAGTTGGTGATACTGATAATGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070339    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008135.1-1809s1c1
Sequence:CCGGGCCAATCACCTACAACCACTACTCGAGTAGTGGTTGTAGGTGATTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070341    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008135.1-600s1c1
Sequence:CCGGCATCTACTACAACGTGGTCATCTCGAGATGACCACGTTGTAGTAGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070340    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008135.1-1680s1c1
Sequence:CCGGCCGTAACTACTTCCAGGACATCTCGAGATGTCCTGGAAGTAGTTACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070342    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008135.1-1749s1c1
Sequence:CCGGGCGCTTTGTTTCTCCGGCTATCTCGAGATAGCCGGAGAAACAAAGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008135
VALIDATED
SLC6A9 MISSION shRNA Lentiviral Transduction Particles
solute carrier family 6 (neurotransmitter transporter, glycine), member 9
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000070338    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008135.1-1209s1c1
Sequence:CCGGCGTCATTATCAGTATCACCAACTCGAGTTGGTGATACTGATAATGACGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070339    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008135.1-1809s1c1
Sequence:CCGGGCCAATCACCTACAACCACTACTCGAGTAGTGGTTGTAGGTGATTGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070341    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008135.1-600s1c1
Sequence:CCGGCATCTACTACAACGTGGTCATCTCGAGATGACCACGTTGTAGTAGATGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070340    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008135.1-1680s1c1
Sequence:CCGGCCGTAACTACTTCCAGGACATCTCGAGATGTCCTGGAAGTAGTTACGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070342    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008135.1-1749s1c1
Sequence:CCGGGCGCTTTGTTTCTCCGGCTATCTCGAGATAGCCGGAGAAACAAAGCGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)