EMAIL THIS PAGE TO A FRIEND

SLC7A11

solute carrier family 7 (anionic amino acid transporter light chain, xc- system), member 11

248 Gene Product Result for
Synonyms: CCBR1 xCT
UniProtKB ID: Q9UPY5, A8K2U4
Gene ID:
Human(23657) Summary: This gene encodes a member of a heteromeric, sodium-independent, anionic amino acid transport system that is highly specific for cysteine and glutamate. In this system, designated Xc(-), the anionic form of cysteine is transported in exchange for glutamate. This protein has been identified as the predominant mediator of Kaposi sarcoma-associated herpesvirus fusion and entry permissiveness into cells. Also, increased expression of this gene in primary gliomas (compared to normal brain tissue) was associated with increased glutamate secretion via the XCT channels, resulting in neuronal cell death. [provided by RefSeq, Sep 2011]
Mouse(26570) solute carrier family 7 (cationic amino acid transporter, y+ system), member 11
Rat(310392) solute carrier family 7 (anionic amino acid transporter light chain, xc- system), member 11
chicken(428731) solute carrier family 7 (anionic amino acid transporter light chain, xc- system), member 11
dog(483821) solute carrier family 7 (anionic amino acid transporter light chain, xc- system), member 11
domestic cat(101099374) solute carrier family 7 (anionic amino acid transporter light chain, xc- system), member 11
domestic guinea pig(100735308) solute carrier family 7 (anionic amino acid transporter light chain, xc- system), member 11
naked mole-rat(101709765) solute carrier family 7 (anionic amino acid transporter light chain, xc- system), member 11
cow(524078) solute carrier family 7 (anionic amino acid transporter light chain, xc- system), member 11
sheep(100820755) solute carrier family 7 (anionic amino acid transporter light chain, xc- system), member 11
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014331 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014331 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014331 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011990 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011990 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011990 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU070231 MISSION® esiRNA targeting human SLC7A11 human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014331 Rosetta Predictions human pricing
NM_001107673 Rosetta Predictions rat pricing
NM_011990 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014331 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00345461 predicted 1079
2 SASI_Hs01_00158008 predicted 1103
3 SASI_Hs01_00158009 predicted 1523
4 SASI_Hs01_00158010 predicted 1338
5 SASI_Hs01_00158011 predicted 1602
6 SASI_Hs01_00158012 predicted 1212
7 SASI_Hs02_00345462 predicted 800
8 SASI_Hs01_00158013 predicted 1784
9 SASI_Hs01_00158014 predicted 472
10 SASI_Hs01_00158015 predicted 1295
11 SASI_Hs01_00158006 predicted 923
12 SASI_Hs01_00158007 predicted 1668
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107673 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00231145 predicted 751
2 SASI_Rn02_00231146 predicted 1587
3 SASI_Rn02_00231147 predicted 1595
4 SASI_Rn02_00231148 predicted 1449
5 SASI_Rn02_00231149 predicted 1726
6 SASI_Rn02_00231150 predicted 1618
7 SASI_Rn02_00231151 predicted 1640
8 SASI_Rn02_00231152 predicted 1640
9 SASI_Rn02_00231153 predicted 1409
10 SASI_Rn02_00231154 predicted 565
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011990 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00132970 predicted 968
2 SASI_Mm01_00132971 predicted 1838
3 SASI_Mm01_00132972 predicted 1806
4 SASI_Mm02_00321916 predicted 742
5 SASI_Mm01_00132973 predicted 1809
6 SASI_Mm01_00132974 predicted 641
7 SASI_Mm01_00132975 predicted 1845
8 SASI_Mm01_00132976 predicted 1405
9 SASI_Mm01_00132977 predicted 1415
10 SASI_Mm01_00132978 predicted 1795
11 SASI_Mm01_00132979 predicted 989
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014331
VALIDATED
SLC7A11 MISSION shRNA Bacterial Glycerol Stock
solute carrier family 7 (anionic amino acid transporter light chain, xc- system), member 11
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000043123    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_014331.2-264s1c1
Sequence:CCGGCCTGTCACTATTTGGAGCTTTCTCGAGAAAGCTCCAAATAGTGACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043125    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_014331.2-1384s1c1
Sequence:CCGGCCTGCGTATTATCTCTTTATTCTCGAGAATAAAGAGATAATACGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043126    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_014331.2-621s1c1
Sequence:CCGGCCCTGGAGTTATGCAGCTAATCTCGAGATTAGCTGCATAACTCCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288866    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014331.3-1396s21c1
Sequence:CCGGGCACCCTTTGACAATGATAATCTCGAGATTATCATTGTCAAAGGGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043124    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014331.2-1116s1c1
Sequence:CCGGGCACCCTTTGACAATGATAATCTCGAGATTATCATTGTCAAAGGGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014331.2-1218s1c1
Sequence:CCGGGCTGATTTATCTTCGATACAACTCGAGTTGTATCGAAGATAAATCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380471    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_014331.3-1605s21c1
Sequence:GTACCGGCCCTCTATTCGGACCCATTTACTCGAGTAAATGGGTCCGAATAGAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380361    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 2 Clone ID:NM_014331.3-624s21c1
Sequence:GTACCGGTGGAAGTCTTTGGTCCATTACCTCGAGGTAATGGACCAAAGACTTCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288865    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_014331.3-1664s21c1
Sequence:CCGGCCTGCGTATTATCTCTTTATTCTCGAGAATAAAGAGATAATACGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000382445    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014331.3-1227s21c1
Sequence:GTACCGGCATTAGCAGTTCCGATCTTTGCTCGAGCAAAGATCGGAACTGCTAATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288926    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014331.3-901s21c1
Sequence:CCGGCCCTGGAGTTATGCAGCTAATCTCGAGATTAGCTGCATAACTCCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288927    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014331.3-544s21c1
Sequence:CCGGCCTGTCACTATTTGGAGCTTTCTCGAGAAAGCTCCAAATAGTGACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296035    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014331.3-1995s21c1
Sequence:CCGGTATTCTATGAGTCGCACAATTCTCGAGAATTGTGCGACTCATAGAATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014331
VALIDATED
SLC7A11 MISSION shRNA shRNA Plasmid DNA
solute carrier family 7 (anionic amino acid transporter light chain, xc- system), member 11
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000043123    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_014331.2-264s1c1
Sequence:CCGGCCTGTCACTATTTGGAGCTTTCTCGAGAAAGCTCCAAATAGTGACAGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000043125    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_014331.2-1384s1c1
Sequence:CCGGCCTGCGTATTATCTCTTTATTCTCGAGAATAAAGAGATAATACGCAGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000043126    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_014331.2-621s1c1
Sequence:CCGGCCCTGGAGTTATGCAGCTAATCTCGAGATTAGCTGCATAACTCCAGGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000288866    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014331.3-1396s21c1
Sequence:CCGGGCACCCTTTGACAATGATAATCTCGAGATTATCATTGTCAAAGGGTGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000043124    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014331.2-1116s1c1
Sequence:CCGGGCACCCTTTGACAATGATAATCTCGAGATTATCATTGTCAAAGGGTGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000043127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014331.2-1218s1c1
Sequence:CCGGGCTGATTTATCTTCGATACAACTCGAGTTGTATCGAAGATAAATCAGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000380471    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_014331.3-1605s21c1
Sequence:GTACCGGCCCTCTATTCGGACCCATTTACTCGAGTAAATGGGTCCGAATAGAGGGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000380361    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 2 Clone ID:NM_014331.3-624s21c1
Sequence:GTACCGGTGGAAGTCTTTGGTCCATTACCTCGAGGTAATGGACCAAAGACTTCCATTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000288865    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_014331.3-1664s21c1
Sequence:CCGGCCTGCGTATTATCTCTTTATTCTCGAGAATAAAGAGATAATACGCAGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000382445    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014331.3-1227s21c1
Sequence:GTACCGGCATTAGCAGTTCCGATCTTTGCTCGAGCAAAGATCGGAACTGCTAATGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000288926    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014331.3-901s21c1
Sequence:CCGGCCCTGGAGTTATGCAGCTAATCTCGAGATTAGCTGCATAACTCCAGGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000288927    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014331.3-544s21c1
Sequence:CCGGCCTGTCACTATTTGGAGCTTTCTCGAGAAAGCTCCAAATAGTGACAGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000296035    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014331.3-1995s21c1
Sequence:CCGGTATTCTATGAGTCGCACAATTCTCGAGAATTGTGCGACTCATAGAATATTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014331
VALIDATED
SLC7A11 MISSION shRNA Lentiviral Transduction Particles
solute carrier family 7 (anionic amino acid transporter light chain, xc- system), member 11
Human
13 Products Total
TRC Number Volume Titer/mL Vector Price Set Price (5+)? Select
TRCN0000043123    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_014331.2-264s1c1
Sequence:CCGGCCTGTCACTATTTGGAGCTTTCTCGAGAAAGCTCCAAATAGTGACAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043125    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_014331.2-1384s1c1
Sequence:CCGGCCTGCGTATTATCTCTTTATTCTCGAGAATAAAGAGATAATACGCAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043126    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_014331.2-621s1c1
Sequence:CCGGCCCTGGAGTTATGCAGCTAATCTCGAGATTAGCTGCATAACTCCAGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000288866    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014331.3-1396s21c1
Sequence:CCGGGCACCCTTTGACAATGATAATCTCGAGATTATCATTGTCAAAGGGTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043124    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014331.2-1116s1c1
Sequence:CCGGGCACCCTTTGACAATGATAATCTCGAGATTATCATTGTCAAAGGGTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014331.2-1218s1c1
Sequence:CCGGGCTGATTTATCTTCGATACAACTCGAGTTGTATCGAAGATAAATCAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380471    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_014331.3-1605s21c1
Sequence:GTACCGGCCCTCTATTCGGACCCATTTACTCGAGTAAATGGGTCCGAATAGAGGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380361    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 2 Clone ID:NM_014331.3-624s21c1
Sequence:GTACCGGTGGAAGTCTTTGGTCCATTACCTCGAGGTAATGGACCAAAGACTTCCATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000288865    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_014331.3-1664s21c1
Sequence:CCGGCCTGCGTATTATCTCTTTATTCTCGAGAATAAAGAGATAATACGCAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000382445    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014331.3-1227s21c1
Sequence:GTACCGGCATTAGCAGTTCCGATCTTTGCTCGAGCAAAGATCGGAACTGCTAATGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000288926    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014331.3-901s21c1
Sequence:CCGGCCCTGGAGTTATGCAGCTAATCTCGAGATTAGCTGCATAACTCCAGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000288927    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014331.3-544s21c1
Sequence:CCGGCCTGTCACTATTTGGAGCTTTCTCGAGAAAGCTCCAAATAGTGACAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296035    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014331.3-1995s21c1
Sequence:CCGGTATTCTATGAGTCGCACAATTCTCGAGAATTGTGCGACTCATAGAATATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011990
VALIDATED
SLC7A11 MISSION shRNA Bacterial Glycerol Stock
solute carrier family 7 (anionic amino acid transporter light chain, xc- system), member 11
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000079425    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011990.1-1702s1c1
Sequence:CCGGCCCTGCATATTATCTCTTCATCTCGAGATGAAGAGATAATATGCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000079423    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011990.1-2004s1c1
Sequence:CCGGGCAAGCTAATATGCAAGTCATCTCGAGATGACTTGCATATTAGCTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000079424    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011990.1-940s1c1
Sequence:CCGGCCCTGGAGTTATACAGCTAATCTCGAGATTAGCTGTATAACTCCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000079427    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011990.1-1373s1c1
Sequence:CCGGCCGGAAATCCTCTCTATGATTCTCGAGAATCATAGAGAGGATTTCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000079426    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011990.1-599s1c1
Sequence:CCGGGCCCTGTCCTATGCAGAATTACTCGAGTAATTCTGCATAGGACAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380712    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011990.2-976s21c1
Sequence:GTACCGGTGGAGTTATACAGCTAATTAACTCGAGTTAATTAGCTGTATAACTCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324192    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011990.2-2037s21c1
Sequence:CCGGGCAAGCTAATATGCAAGTCATCTCGAGATGACTTGCATATTAGCTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349040    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011990.2-1773s21c1
Sequence:CCGGCCAAGTGGTTCAGACGATTATCTCGAGATAATCGTCTGAACCACTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324122    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011990.2-632s21c1
Sequence:CCGGGCCCTGTCCTATGCAGAATTACTCGAGTAATTCTGCATAGGACAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305655    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011990.2-1299s21c1
Sequence:CCGGCATTAGCAGTCCCGATCTTTGCTCGAGCAAAGATCGGGACTGCTAATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311401    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011990.2-734s21c1
Sequence:CCGGTGGGTGGAACTGCTCGTAATACTCGAGTATTACGAGCAGTTCCACCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011990
VALIDATED
SLC7A11 MISSION shRNA shRNA Plasmid DNA
solute carrier family 7 (anionic amino acid transporter light chain, xc- system), member 11
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000079425    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011990.1-1702s1c1
Sequence:CCGGCCCTGCATATTATCTCTTCATCTCGAGATGAAGAGATAATATGCAGGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000079423    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011990.1-2004s1c1
Sequence:CCGGGCAAGCTAATATGCAAGTCATCTCGAGATGACTTGCATATTAGCTTGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000079424    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011990.1-940s1c1
Sequence:CCGGCCCTGGAGTTATACAGCTAATCTCGAGATTAGCTGTATAACTCCAGGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000079427    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011990.1-1373s1c1
Sequence:CCGGCCGGAAATCCTCTCTATGATTCTCGAGAATCATAGAGAGGATTTCCGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000079426    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011990.1-599s1c1
Sequence:CCGGGCCCTGTCCTATGCAGAATTACTCGAGTAATTCTGCATAGGACAGGGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000380712    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011990.2-976s21c1
Sequence:GTACCGGTGGAGTTATACAGCTAATTAACTCGAGTTAATTAGCTGTATAACTCCATTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000324192    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011990.2-2037s21c1
Sequence:CCGGGCAAGCTAATATGCAAGTCATCTCGAGATGACTTGCATATTAGCTTGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000349040    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011990.2-1773s21c1
Sequence:CCGGCCAAGTGGTTCAGACGATTATCTCGAGATAATCGTCTGAACCACTTGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000324122    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011990.2-632s21c1
Sequence:CCGGGCCCTGTCCTATGCAGAATTACTCGAGTAATTCTGCATAGGACAGGGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000305655    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011990.2-1299s21c1
Sequence:CCGGCATTAGCAGTCCCGATCTTTGCTCGAGCAAAGATCGGGACTGCTAATGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000311401    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011990.2-734s21c1
Sequence:CCGGTGGGTGGAACTGCTCGTAATACTCGAGTATTACGAGCAGTTCCACCCATTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011990
VALIDATED
SLC7A11 MISSION shRNA Lentiviral Transduction Particles
solute carrier family 7 (anionic amino acid transporter light chain, xc- system), member 11
Mouse
11 Products Total
TRC Number Volume Titer/mL Vector Price Set Price (5+)? Select
TRCN0000079425    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011990.1-1702s1c1
Sequence:CCGGCCCTGCATATTATCTCTTCATCTCGAGATGAAGAGATAATATGCAGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000079423    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011990.1-2004s1c1
Sequence:CCGGGCAAGCTAATATGCAAGTCATCTCGAGATGACTTGCATATTAGCTTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000079424    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011990.1-940s1c1
Sequence:CCGGCCCTGGAGTTATACAGCTAATCTCGAGATTAGCTGTATAACTCCAGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000079427    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011990.1-1373s1c1
Sequence:CCGGCCGGAAATCCTCTCTATGATTCTCGAGAATCATAGAGAGGATTTCCGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000079426    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011990.1-599s1c1
Sequence:CCGGGCCCTGTCCTATGCAGAATTACTCGAGTAATTCTGCATAGGACAGGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380712    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011990.2-976s21c1
Sequence:GTACCGGTGGAGTTATACAGCTAATTAACTCGAGTTAATTAGCTGTATAACTCCATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000324192    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011990.2-2037s21c1
Sequence:CCGGGCAAGCTAATATGCAAGTCATCTCGAGATGACTTGCATATTAGCTTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000349040    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011990.2-1773s21c1
Sequence:CCGGCCAAGTGGTTCAGACGATTATCTCGAGATAATCGTCTGAACCACTTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000324122    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011990.2-632s21c1
Sequence:CCGGGCCCTGTCCTATGCAGAATTACTCGAGTAATTCTGCATAGGACAGGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000305655    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011990.2-1299s21c1
Sequence:CCGGCATTAGCAGTCCCGATCTTTGCTCGAGCAAAGATCGGGACTGCTAATGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000311401    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011990.2-734s21c1
Sequence:CCGGTGGGTGGAACTGCTCGTAATACTCGAGTATTACGAGCAGTTCCACCCATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)