EMAIL THIS PAGE TO A FRIEND

SLC7A13

solute carrier family 7 (anionic amino acid transporter), member 13

62 Gene Product Result for
Synonyms: AGT-1 AGT1 XAT2
UniProtKB ID: Q8TCU3, Q05C37, Q08AH9, Q96N84
Gene ID:
Mouse(74087) solute carrier family 7, (cationic amino acid transporter, y+ system) member 13
Rat(313089) solute carrier family 7 (anionic amino acid transporter), member 13
domestic guinea pig(100718079) solute carrier family 7 (anionic amino acid transporter), member 13
naked mole-rat(101726716) solute carrier family 7 (anionic amino acid transporter), member 13
cow(787492) solute carrier family 7 (anionic amino acid transporter), member 13
sheep(101112828) solute carrier family 7 (anionic amino acid transporter), member 13
chicken(420204) solute carrier family 7 (anionic amino acid transporter), member 13
domestic cat(101097374) solute carrier family 7 (anionic amino acid transporter), member 13
dog(100684372) solute carrier family 7 (anionic amino acid transporter), member 13
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_028746 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028746 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028746 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_138817 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_138817 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_138817 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU019391 MISSION® esiRNA esiRNA targeting human SLC7A13 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_138817 Rosetta Predictions human pricing
NM_001012100 Rosetta Predictions rat pricing
XM_575781 Rosetta Predictions rat pricing
NM_028746 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138817 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00015967 predicted 1153
2 SASI_Hs01_00015969 predicted 859
3 SASI_Hs01_00015970 predicted 979
4 SASI_Hs01_00015971 predicted 698
5 SASI_Hs01_00015972 predicted 586
6 SASI_Hs01_00015974 predicted 991
7 SASI_Hs01_00015975 predicted 902
8 SASI_Hs02_00363983 predicted 884
9 SASI_Hs01_00015976 predicted 1033
10 SASI_Hs02_00363984 predicted 1440
11 SASI_Hs01_00015968 predicted 1455
12 SASI_Hs01_00015973 predicted 1453
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012100 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00083752 predicted 336
2 SASI_Rn01_00083754 predicted 274
3 SASI_Rn01_00083755 predicted 1474
4 SASI_Rn01_00083756 predicted 1406
5 SASI_Rn01_00083757 predicted 473
6 SASI_Rn01_00083758 predicted 1520
7 SASI_Rn01_00083759 predicted 673
8 SASI_Rn02_00200235 predicted 544
9 SASI_Rn01_00083760 predicted 800
10 SASI_Rn02_00200236 predicted 1505
11 SASI_Rn01_00083753 predicted 818
12 SASI_Rn01_00083761 predicted 1375
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_575781 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00134138 predicted 338
2 SASI_Rn01_00134139 predicted 371
3 SASI_Rn01_00134140 predicted 278
4 SASI_Rn01_00134141 predicted 276
5 SASI_Rn01_00134142 predicted 248
6 SASI_Rn01_00134143 predicted 380
7 SASI_Rn01_00134144 predicted 405
8 SASI_Rn01_00134145 predicted 391
9 SASI_Rn01_00134146 predicted 372
10 SASI_Rn01_00134147 predicted 387
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028746 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00056777 predicted 984
2 SASI_Mm01_00056778 predicted 613
3 SASI_Mm01_00056779 predicted 1521
4 SASI_Mm02_00334326 predicted 1070
5 SASI_Mm01_00056780 predicted 267
6 SASI_Mm01_00056781 predicted 1137
7 SASI_Mm01_00056782 predicted 816
8 SASI_Mm01_00056784 predicted 1168
9 SASI_Mm01_00056785 predicted 969
10 SASI_Mm02_00334327 predicted 1312
11 SASI_Mm01_00056783 predicted 263
12 SASI_Mm01_00056786 predicted 1165
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028746
SLC7A13 MISSION shRNA Bacterial Glycerol Stock
solute carrier family 7 (anionic amino acid transporter), member 13
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000079484    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028746.2-1372s1c1
Sequence:CCGGCGTGCCATTGATACACTTTAACTCGAGTTAAAGTGTATCAATGGCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000079483    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028746.2-1515s1c1
Sequence:CCGGCCATACTGTGTTCCAGATAAACTCGAGTTTATCTGGAACACAGTATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000079487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028746.2-1071s1c1
Sequence:CCGGCCTTTATAGCTGTGCTACTAACTCGAGTTAGTAGCACAGCTATAAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000079485    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028746.2-1220s1c1
Sequence:CCGGCCCAATCTACACAGACCATATCTCGAGATATGGTCTGTGTAGATTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000079486    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028746.2-1219s1c1
Sequence:CCGGGCCCAATCTACACAGACCATACTCGAGTATGGTCTGTGTAGATTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028746
SLC7A13 MISSION shRNA shRNA Plasmid DNA
solute carrier family 7 (anionic amino acid transporter), member 13
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000079484    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028746.2-1372s1c1
Sequence:CCGGCGTGCCATTGATACACTTTAACTCGAGTTAAAGTGTATCAATGGCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000079483    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028746.2-1515s1c1
Sequence:CCGGCCATACTGTGTTCCAGATAAACTCGAGTTTATCTGGAACACAGTATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000079487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028746.2-1071s1c1
Sequence:CCGGCCTTTATAGCTGTGCTACTAACTCGAGTTAGTAGCACAGCTATAAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000079485    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028746.2-1220s1c1
Sequence:CCGGCCCAATCTACACAGACCATATCTCGAGATATGGTCTGTGTAGATTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000079486    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028746.2-1219s1c1
Sequence:CCGGGCCCAATCTACACAGACCATACTCGAGTATGGTCTGTGTAGATTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028746
SLC7A13 MISSION shRNA Lentiviral Transduction Particles
solute carrier family 7 (anionic amino acid transporter), member 13
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000079484    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028746.2-1372s1c1
Sequence:CCGGCGTGCCATTGATACACTTTAACTCGAGTTAAAGTGTATCAATGGCACGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000079483    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028746.2-1515s1c1
Sequence:CCGGCCATACTGTGTTCCAGATAAACTCGAGTTTATCTGGAACACAGTATGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000079487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028746.2-1071s1c1
Sequence:CCGGCCTTTATAGCTGTGCTACTAACTCGAGTTAGTAGCACAGCTATAAAGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000079485    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028746.2-1220s1c1
Sequence:CCGGCCCAATCTACACAGACCATATCTCGAGATATGGTCTGTGTAGATTGGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000079486    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028746.2-1219s1c1
Sequence:CCGGGCCCAATCTACACAGACCATACTCGAGTATGGTCTGTGTAGATTGGGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138817
SLC7A13 MISSION shRNA Bacterial Glycerol Stock
solute carrier family 7 (anionic amino acid transporter), member 13
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000043164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138817.1-494s1c1
Sequence:CCGGGCCTAAGAAATGTCTGGCATTCTCGAGAATGCCAGACATTTCTTAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043163    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138817.1-1335s1c1
Sequence:CCGGCCATTGGTAAAGTCTCCAAATCTCGAGATTTGGAGACTTTACCAATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043167    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138817.1-1490s1c1
Sequence:CCGGCCCTGATGTGTCTGAGGAATACTCGAGTATTCCTCAGACACATCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043166    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138817.1-600s1c1
Sequence:CCGGGTGTCCATACTTAGCTTCATTCTCGAGAATGAAGCTAAGTATGGACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043165    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138817.1-1193s1c1
Sequence:CCGGCACGGGTTCATTATGGTCTATCTCGAGATAGACCATAATGAACCCGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436128    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138817.2-1382s21c1
Sequence:CCGGAGTTCTCAGCGGATTACTATTCTCGAGAATAGTAATCCGCTGAGAACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420322    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138817.2-1563s21c1
Sequence:CCGGAGATTCCAAATCAAGGTTAAACTCGAGTTTAACCTTGATTTGGAATCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423241    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138817.2-951s21c1
Sequence:CCGGCCCTCATTAGCATGGATTATGCTCGAGCATAATCCATGCTAATGAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138817
SLC7A13 MISSION shRNA shRNA Plasmid DNA
solute carrier family 7 (anionic amino acid transporter), member 13
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000043164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138817.1-494s1c1
Sequence:CCGGGCCTAAGAAATGTCTGGCATTCTCGAGAATGCCAGACATTTCTTAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043163    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138817.1-1335s1c1
Sequence:CCGGCCATTGGTAAAGTCTCCAAATCTCGAGATTTGGAGACTTTACCAATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043167    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138817.1-1490s1c1
Sequence:CCGGCCCTGATGTGTCTGAGGAATACTCGAGTATTCCTCAGACACATCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043166    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138817.1-600s1c1
Sequence:CCGGGTGTCCATACTTAGCTTCATTCTCGAGAATGAAGCTAAGTATGGACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043165    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138817.1-1193s1c1
Sequence:CCGGCACGGGTTCATTATGGTCTATCTCGAGATAGACCATAATGAACCCGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000436128    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138817.2-1382s21c1
Sequence:CCGGAGTTCTCAGCGGATTACTATTCTCGAGAATAGTAATCCGCTGAGAACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420322    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138817.2-1563s21c1
Sequence:CCGGAGATTCCAAATCAAGGTTAAACTCGAGTTTAACCTTGATTTGGAATCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423241    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138817.2-951s21c1
Sequence:CCGGCCCTCATTAGCATGGATTATGCTCGAGCATAATCCATGCTAATGAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138817
SLC7A13 MISSION shRNA Lentiviral Transduction Particles
solute carrier family 7 (anionic amino acid transporter), member 13
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000043164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138817.1-494s1c1
Sequence:CCGGGCCTAAGAAATGTCTGGCATTCTCGAGAATGCCAGACATTTCTTAGGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000043163    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138817.1-1335s1c1
Sequence:CCGGCCATTGGTAAAGTCTCCAAATCTCGAGATTTGGAGACTTTACCAATGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000043167    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138817.1-1490s1c1
Sequence:CCGGCCCTGATGTGTCTGAGGAATACTCGAGTATTCCTCAGACACATCAGGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000043166    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138817.1-600s1c1
Sequence:CCGGGTGTCCATACTTAGCTTCATTCTCGAGAATGAAGCTAAGTATGGACACTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000043165    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138817.1-1193s1c1
Sequence:CCGGCACGGGTTCATTATGGTCTATCTCGAGATAGACCATAATGAACCCGTGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000436128    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138817.2-1382s21c1
Sequence:CCGGAGTTCTCAGCGGATTACTATTCTCGAGAATAGTAATCCGCTGAGAACTTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000420322    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138817.2-1563s21c1
Sequence:CCGGAGATTCCAAATCAAGGTTAAACTCGAGTTTAACCTTGATTTGGAATCTTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000423241    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138817.2-951s21c1
Sequence:CCGGCCCTCATTAGCATGGATTATGCTCGAGCATAATCCATGCTAATGAGGGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???