EMAIL THIS PAGE TO A FRIEND

SLC7A3

solute carrier family 7 (cationic amino acid transporter, y+ system), member 3

62 Gene Product Result for
Synonyms: ATRC3 CAT-3 CAT3
UniProtKB ID: Q8WY07, D3DVU7, Q5JQR2, Q8N185, Q8NCA7, Q96SZ7
Gene ID:
Human(84889) Summary: This gene encodes a member of the solute carrier family 7. The encoded protein is a sodium-independent cationic amino acid transporter. Alternate splicing results in multiple transcripts that encoded the same protein.[provided by RefSeq, May 2010]
Mouse(11989) solute carrier family 7 (cationic amino acid transporter, y+ system), member 3
Rat(29485) solute carrier family 7 (cationic amino acid transporter, y+ system), member 3
naked mole-rat(101711690) solute carrier family 7 (cationic amino acid transporter, y+ system), member 3
domestic guinea pig(100715043) solute carrier family 7 (cationic amino acid transporter, y+ system), member 3
cow(539065) solute carrier family 7 (cationic amino acid transporter, y+ system), member 3
sheep(101122005) solute carrier family 7 (cationic amino acid transporter, y+ system), member 3
sheep(100302386) solute carrier family 7 (cationic amino acid transporter, y+ system), member 3
chicken(422213) solute carrier family 7 (cationic amino acid transporter, y+ system), member 3
domestic cat(101089172) solute carrier family 7 (cationic amino acid transporter, y+ system), member 3
Horse(100055782) solute carrier family 7 (cationic amino acid transporter, y+ system), member 3
dog(491945) solute carrier family 7 (cationic amino acid transporter, y+ system), member 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007515 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007515 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007515 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_032803 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032803 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032803 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001048164 Rosetta Predictions human pricing
NM_032803 Rosetta Predictions human pricing
NM_017217 Rosetta Predictions rat pricing
NM_007515 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001048164 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00311532 predicted 1298
2 SASI_Hs02_00311533 predicted 789
3 SASI_Hs02_00311534 predicted 738
4 SASI_Hs02_00311535 predicted 1679
5 SASI_Hs02_00311536 predicted 1909
6 SASI_Hs02_00311537 predicted 1374
7 SASI_Hs02_00311538 predicted 1554
8 SASI_Hs02_00311539 predicted 1804
9 SASI_Hs02_00311540 predicted 723
10 SASI_Hs02_00311541 predicted 912
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032803 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00034429 predicted 1319
2 SASI_Hs01_00034430 predicted 806
3 SASI_Hs01_00034431 predicted 767
4 SASI_Hs01_00034432 predicted 1709
5 SASI_Hs01_00034433 predicted 1933
6 SASI_Hs01_00034435 predicted 1401
7 SASI_Hs01_00034436 predicted 1578
8 SASI_Hs01_00034437 predicted 1823
9 SASI_Hs02_00360365 predicted 750
10 SASI_Hs01_00034438 predicted 935
11 SASI_Hs01_00034434 predicted 693
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017217 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00068061 predicted 1176
2 SASI_Rn01_00068062 predicted 480
3 SASI_Rn02_00261582 predicted 1807
4 SASI_Rn01_00068063 predicted 1872
5 SASI_Rn01_00068064 predicted 318
6 SASI_Rn01_00068065 predicted 662
7 SASI_Rn01_00068066 predicted 685
8 SASI_Rn01_00068067 predicted 358
9 SASI_Rn01_00068068 predicted 1437
10 SASI_Rn01_00068070 predicted 1063
11 SASI_Rn01_00068069 predicted 478
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007515 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00084665 predicted 282
2 SASI_Mm01_00084666 predicted 1555
3 SASI_Mm01_00084667 predicted 916
4 SASI_Mm01_00084668 predicted 1433
5 SASI_Mm01_00084669 predicted 566
6 SASI_Mm02_00311817 predicted 1534
7 SASI_Mm01_00084670 predicted 1316
8 SASI_Mm01_00084671 predicted 1419
9 SASI_Mm01_00084672 predicted 375
10 SASI_Mm01_00084673 predicted 982
11 SASI_Mm01_00084674 predicted 1440
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007515
SLC7A3 MISSION shRNA Bacterial Glycerol Stock
solute carrier family 7 (cationic amino acid transporter, y+ system), member 3
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000079383    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007515.1-2161s1c1
Sequence:CCGGCCTATACAATAATGGAGAGTACTCGAGTACTCTCCATTATTGTATAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000079387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007515.1-1270s1c1
Sequence:CCGGGCCCGCTACTTGGTGGCTATTCTCGAGAATAGCCACCAAGTAGCGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000079384    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007515.1-1724s1c1
Sequence:CCGGCCGTACTACTAACTGTTCTTTCTCGAGAAAGAACAGTTAGTAGTACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000079385    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007515.1-446s1c1
Sequence:CCGGCCAAAGATAAAGCAGGACCATCTCGAGATGGTCCTGCTTTATCTTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000079386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007515.1-2080s1c1
Sequence:CCGGGCCCAAACTATAGACCTTGATCTCGAGATCAAGGTCTATAGTTTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434730    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007515.2-973s21c1
Sequence:CCGGACTTGTAGCTTGGACTCTATGCTCGAGCATAGAGTCCAAGCTACAAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438481    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007515.2-505s21c1
Sequence:CCGGGTGTTGGCTGGACTGTGTTATCTCGAGATAACACAGTCCAGCCAACACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425177    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007515.2-2024s21c1
Sequence:CCGGGGATCCAACACAGTATGAAAGCTCGAGCTTTCATACTGTGTTGGATCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007515
SLC7A3 MISSION shRNA shRNA Plasmid DNA
solute carrier family 7 (cationic amino acid transporter, y+ system), member 3
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000079383    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007515.1-2161s1c1
Sequence:CCGGCCTATACAATAATGGAGAGTACTCGAGTACTCTCCATTATTGTATAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000079387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007515.1-1270s1c1
Sequence:CCGGGCCCGCTACTTGGTGGCTATTCTCGAGAATAGCCACCAAGTAGCGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000079384    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007515.1-1724s1c1
Sequence:CCGGCCGTACTACTAACTGTTCTTTCTCGAGAAAGAACAGTTAGTAGTACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000079385    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007515.1-446s1c1
Sequence:CCGGCCAAAGATAAAGCAGGACCATCTCGAGATGGTCCTGCTTTATCTTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000079386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007515.1-2080s1c1
Sequence:CCGGGCCCAAACTATAGACCTTGATCTCGAGATCAAGGTCTATAGTTTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434730    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007515.2-973s21c1
Sequence:CCGGACTTGTAGCTTGGACTCTATGCTCGAGCATAGAGTCCAAGCTACAAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000438481    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007515.2-505s21c1
Sequence:CCGGGTGTTGGCTGGACTGTGTTATCTCGAGATAACACAGTCCAGCCAACACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425177    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007515.2-2024s21c1
Sequence:CCGGGGATCCAACACAGTATGAAAGCTCGAGCTTTCATACTGTGTTGGATCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007515
SLC7A3 MISSION shRNA Lentiviral Transduction Particles
solute carrier family 7 (cationic amino acid transporter, y+ system), member 3
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000079383    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007515.1-2161s1c1
Sequence:CCGGCCTATACAATAATGGAGAGTACTCGAGTACTCTCCATTATTGTATAGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000079387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007515.1-1270s1c1
Sequence:CCGGGCCCGCTACTTGGTGGCTATTCTCGAGAATAGCCACCAAGTAGCGGGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000079384    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007515.1-1724s1c1
Sequence:CCGGCCGTACTACTAACTGTTCTTTCTCGAGAAAGAACAGTTAGTAGTACGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000079385    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007515.1-446s1c1
Sequence:CCGGCCAAAGATAAAGCAGGACCATCTCGAGATGGTCCTGCTTTATCTTTGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000079386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007515.1-2080s1c1
Sequence:CCGGGCCCAAACTATAGACCTTGATCTCGAGATCAAGGTCTATAGTTTGGGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000434730    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007515.2-973s21c1
Sequence:CCGGACTTGTAGCTTGGACTCTATGCTCGAGCATAGAGTCCAAGCTACAAGTTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000438481    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007515.2-505s21c1
Sequence:CCGGGTGTTGGCTGGACTGTGTTATCTCGAGATAACACAGTCCAGCCAACACTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000425177    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007515.2-2024s21c1
Sequence:CCGGGGATCCAACACAGTATGAAAGCTCGAGCTTTCATACTGTGTTGGATCCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032803
SLC7A3 MISSION shRNA Bacterial Glycerol Stock
solute carrier family 7 (cationic amino acid transporter, y+ system), member 3
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000043150    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032803.3-319s1c1
Sequence:CCGGCCATCCATTGTGATCTGCTTTCTCGAGAAAGCAGATCACAATGGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043148    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032803.3-1767s1c1
Sequence:CCGGCCTCCCACTAATGAGCATCTTCTCGAGAAGATGCTCATTAGTGGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043151    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032803.3-901s1c1
Sequence:CCGGGCGACCTGTTTCTATGCATTTCTCGAGAAATGCATAGAAACAGGTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032803.3-1895s1c1
Sequence:CCGGGCCTGGAAGAGATTAAGAGTACTCGAGTACTCTTAATCTCTTCCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043149    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032803.3-814s1c1
Sequence:CCGGGCTGAACTCAATGACACCTATCTCGAGATAGGTGTCATTGAGTTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428584    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032803.4-1486s21c1
Sequence:CCGGAGTTGCAGGAGGAGGCAATAACTCGAGTTATTGCCTCCTCCTGCAACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435538    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032803.4-770s21c1
Sequence:CCGGCATGATCTCTGGCTTCGTTAACTCGAGTTAACGAAGCCAGAGATCATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032803
SLC7A3 MISSION shRNA shRNA Plasmid DNA
solute carrier family 7 (cationic amino acid transporter, y+ system), member 3
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000043150    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032803.3-319s1c1
Sequence:CCGGCCATCCATTGTGATCTGCTTTCTCGAGAAAGCAGATCACAATGGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043148    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032803.3-1767s1c1
Sequence:CCGGCCTCCCACTAATGAGCATCTTCTCGAGAAGATGCTCATTAGTGGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043151    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032803.3-901s1c1
Sequence:CCGGGCGACCTGTTTCTATGCATTTCTCGAGAAATGCATAGAAACAGGTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032803.3-1895s1c1
Sequence:CCGGGCCTGGAAGAGATTAAGAGTACTCGAGTACTCTTAATCTCTTCCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043149    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032803.3-814s1c1
Sequence:CCGGGCTGAACTCAATGACACCTATCTCGAGATAGGTGTCATTGAGTTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428584    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032803.4-1486s21c1
Sequence:CCGGAGTTGCAGGAGGAGGCAATAACTCGAGTTATTGCCTCCTCCTGCAACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000435538    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032803.4-770s21c1
Sequence:CCGGCATGATCTCTGGCTTCGTTAACTCGAGTTAACGAAGCCAGAGATCATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032803
SLC7A3 MISSION shRNA Lentiviral Transduction Particles
solute carrier family 7 (cationic amino acid transporter, y+ system), member 3
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000043150    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032803.3-319s1c1
Sequence:CCGGCCATCCATTGTGATCTGCTTTCTCGAGAAAGCAGATCACAATGGATGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000043148    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032803.3-1767s1c1
Sequence:CCGGCCTCCCACTAATGAGCATCTTCTCGAGAAGATGCTCATTAGTGGGAGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000043151    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032803.3-901s1c1
Sequence:CCGGGCGACCTGTTTCTATGCATTTCTCGAGAAATGCATAGAAACAGGTCGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000043152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032803.3-1895s1c1
Sequence:CCGGGCCTGGAAGAGATTAAGAGTACTCGAGTACTCTTAATCTCTTCCAGGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000043149    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032803.3-814s1c1
Sequence:CCGGGCTGAACTCAATGACACCTATCTCGAGATAGGTGTCATTGAGTTCAGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000428584    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032803.4-1486s21c1
Sequence:CCGGAGTTGCAGGAGGAGGCAATAACTCGAGTTATTGCCTCCTCCTGCAACTTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000435538    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032803.4-770s21c1
Sequence:CCGGCATGATCTCTGGCTTCGTTAACTCGAGTTAACGAAGCCAGAGATCATGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???