EMAIL THIS PAGE TO A FRIEND

SLC7A7

solute carrier family 7 (amino acid transporter light chain, y+L system), member 7

63 Gene Product Result for
Synonyms: LAT3 LPI MOP-2 Y+LAT1 y+LAT-1
Gene ID:
Human(9056) Summary: The protein encoded by this gene is the light subunit of a cationic amino acid transporter. This sodium-independent transporter is formed when the light subunit encoded by this gene dimerizes with the heavy subunit transporter protein SLC3A2. This transporter is found in epithelial cell membranes where it transfers cationic and large neutral amino acids from the cell to the extracellular space. Defects in this gene are a cause of lysinuric protein intolerance (LPI). Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2011]
Mouse(20540) solute carrier family 7 (cationic amino acid transporter, y+ system), member 7
Rat(83509) solute carrier family 7 (amino acid transporter light chain, y+L system), member 7
Zebrafish(641560) solute carrier family 7 (cationic amino acid transporter, y+ system), member 7
domestic cat(101089271) solute carrier family 7 (amino acid transporter light chain, y+L system), member 7
dog(490602) solute carrier family 7 (amino acid transporter light chain, y+L system), member 7
chicken(420216) solute carrier family 7 (amino acid transporter light chain, y+L system), member 7
cow(504220) solute carrier family 7 (amino acid transporter light chain, y+L system), member 7
sheep(101105078) solute carrier family 7 (amino acid transporter light chain, y+L system), member 7
domestic guinea pig(100732596) solute carrier family 7 (amino acid transporter light chain, y+L system), member 7
naked mole-rat(101726108) solute carrier family 7 (amino acid transporter light chain, y+L system), member 7
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011405 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011405 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011405 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003982 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003982 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003982 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001126105 Rosetta Predictions human pricing
NM_001126106 Rosetta Predictions human pricing
NM_003982 Rosetta Predictions human pricing
NM_031341 Rosetta Predictions rat pricing
NM_011405 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001126105 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00328157 predicted 1063
2 SASI_Hs02_00328158 predicted 1032
3 SASI_Hs02_00328159 predicted 1504
4 SASI_Hs02_00328160 predicted 1711
5 SASI_Hs02_00328161 predicted 1776
6 SASI_Hs02_00328162 predicted 1101
7 SASI_Hs02_00328163 predicted 780
8 SASI_Hs02_00328164 predicted 1121
9 SASI_Hs02_00328165 predicted 698
10 SASI_Hs02_00328166 predicted 1663
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001126106 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00328167 predicted 1200
2 SASI_Hs02_00328168 predicted 1163
3 SASI_Hs02_00328169 predicted 1638
4 SASI_Hs02_00328170 predicted 1847
5 SASI_Hs02_00328171 predicted 1904
6 SASI_Hs02_00328172 predicted 1237
7 SASI_Hs02_00328173 predicted 915
8 SASI_Hs02_00328174 predicted 1254
9 SASI_Hs02_00328175 predicted 834
10 SASI_Hs02_00328176 predicted 1790
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003982 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00067544 predicted 1439
2 SASI_Hs01_00067545 predicted 1415
3 SASI_Hs01_00067546 predicted 1880
4 SASI_Hs02_00336678 predicted 2089
5 SASI_Hs01_00067547 predicted 2153
6 SASI_Hs01_00067548 predicted 1483
7 SASI_Hs01_00067550 predicted 1157
8 SASI_Hs01_00067551 predicted 1499
9 SASI_Hs01_00067552 predicted 1080
10 SASI_Hs01_00067553 predicted 2043
11 SASI_Hs01_00067549 predicted 1172
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031341 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00082770 predicted 1030
2 SASI_Rn01_00082772 predicted 692
3 SASI_Rn01_00082773 predicted 1278
4 SASI_Rn01_00082774 predicted 1754
5 SASI_Rn01_00082775 predicted 561
6 SASI_Rn01_00082776 predicted 766
7 SASI_Rn01_00082777 predicted 384
8 SASI_Rn02_00264575 predicted 1156
9 SASI_Rn01_00082779 predicted 1371
10 SASI_Rn02_00264576 predicted 849
11 SASI_Rn01_00082771 predicted 1662
12 SASI_Rn01_00082778 predicted 1248
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011405 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00066924 predicted 1315
2 SASI_Mm01_00066925 predicted 1903
3 SASI_Mm01_00066926 predicted 1129
4 SASI_Mm01_00066927 predicted 904
5 SASI_Mm01_00066930 predicted 1541
6 SASI_Mm02_00320615 predicted 1128
7 SASI_Mm02_00320616 predicted 1445
8 SASI_Mm01_00066931 predicted 1952
9 SASI_Mm01_00066932 predicted 1526
10 SASI_Mm01_00066933 predicted 1238
11 SASI_Mm01_00066928 predicted 1657
12 SASI_Mm01_00066929 predicted 1428
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011405
VALIDATED
SLC7A7 MISSION shRNA Bacterial Glycerol Stock
solute carrier family 7 (amino acid transporter light chain, y+L system), member 7
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000079412    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011405.1-1059s1c1
Sequence:CCGGCGTCACCATCATCTACCTCTTCTCGAGAAGAGGTAGATGATGGTGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000079408    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011405.1-1927s1c1
Sequence:CCGGGCTACATGTTTCAGACTTCATCTCGAGATGAAGTCTGAAACATGTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000079409    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011405.1-1291s1c1
Sequence:CCGGGCCATCTGTATGGTTCATGTTCTCGAGAACATGAACCATACAGATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000079411    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011405.1-1726s1c1
Sequence:CCGGGCAGAAATGGACTTGGAAGATCTCGAGATCTTCCAAGTCCATTTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000079410    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011405.1-886s1c1
Sequence:CCGGGCTAACTTTGAGAACTCCTTTCTCGAGAAAGGAGTTCTCAAAGTTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324190    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011405.3-1213s21c1
Sequence:CCGGCGTCACCATCATCTACCTCTTCTCGAGAAGAGGTAGATGATGGTGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324188    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011405.3-2081s21c1
Sequence:CCGGGCTACATGTTTCAGACTTCATCTCGAGATGAAGTCTGAAACATGTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324191    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011405.3-1880s21c1
Sequence:CCGGGCAGAAATGGACTTGGAAGATCTCGAGATCTTCCAAGTCCATTTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324189    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011405.3-1445s21c1
Sequence:CCGGGCCATCTGTATGGTTCATGTTCTCGAGAACATGAACCATACAGATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011405
VALIDATED
SLC7A7 MISSION shRNA shRNA Plasmid DNA
solute carrier family 7 (amino acid transporter light chain, y+L system), member 7
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000079412    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011405.1-1059s1c1
Sequence:CCGGCGTCACCATCATCTACCTCTTCTCGAGAAGAGGTAGATGATGGTGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000079408    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011405.1-1927s1c1
Sequence:CCGGGCTACATGTTTCAGACTTCATCTCGAGATGAAGTCTGAAACATGTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000079409    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011405.1-1291s1c1
Sequence:CCGGGCCATCTGTATGGTTCATGTTCTCGAGAACATGAACCATACAGATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000079411    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011405.1-1726s1c1
Sequence:CCGGGCAGAAATGGACTTGGAAGATCTCGAGATCTTCCAAGTCCATTTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000079410    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011405.1-886s1c1
Sequence:CCGGGCTAACTTTGAGAACTCCTTTCTCGAGAAAGGAGTTCTCAAAGTTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000324190    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011405.3-1213s21c1
Sequence:CCGGCGTCACCATCATCTACCTCTTCTCGAGAAGAGGTAGATGATGGTGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000324188    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011405.3-2081s21c1
Sequence:CCGGGCTACATGTTTCAGACTTCATCTCGAGATGAAGTCTGAAACATGTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000324191    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011405.3-1880s21c1
Sequence:CCGGGCAGAAATGGACTTGGAAGATCTCGAGATCTTCCAAGTCCATTTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000324189    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011405.3-1445s21c1
Sequence:CCGGGCCATCTGTATGGTTCATGTTCTCGAGAACATGAACCATACAGATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011405
VALIDATED
SLC7A7 MISSION shRNA Lentiviral Transduction Particles
solute carrier family 7 (amino acid transporter light chain, y+L system), member 7
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000079412    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011405.1-1059s1c1
Sequence:CCGGCGTCACCATCATCTACCTCTTCTCGAGAAGAGGTAGATGATGGTGACGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000079408    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011405.1-1927s1c1
Sequence:CCGGGCTACATGTTTCAGACTTCATCTCGAGATGAAGTCTGAAACATGTAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000079409    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011405.1-1291s1c1
Sequence:CCGGGCCATCTGTATGGTTCATGTTCTCGAGAACATGAACCATACAGATGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000079411    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011405.1-1726s1c1
Sequence:CCGGGCAGAAATGGACTTGGAAGATCTCGAGATCTTCCAAGTCCATTTCTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000079410    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011405.1-886s1c1
Sequence:CCGGGCTAACTTTGAGAACTCCTTTCTCGAGAAAGGAGTTCTCAAAGTTAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000324190    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011405.3-1213s21c1
Sequence:CCGGCGTCACCATCATCTACCTCTTCTCGAGAAGAGGTAGATGATGGTGACGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000324188    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011405.3-2081s21c1
Sequence:CCGGGCTACATGTTTCAGACTTCATCTCGAGATGAAGTCTGAAACATGTAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000324191    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011405.3-1880s21c1
Sequence:CCGGGCAGAAATGGACTTGGAAGATCTCGAGATCTTCCAAGTCCATTTCTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000324189    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011405.3-1445s21c1
Sequence:CCGGGCCATCTGTATGGTTCATGTTCTCGAGAACATGAACCATACAGATGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003982
VALIDATED
SLC7A7 MISSION shRNA Bacterial Glycerol Stock
solute carrier family 7 (amino acid transporter light chain, y+L system), member 7
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000043034    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_003982.2-712s1c1
Sequence:CCGGGCTCATATACAGTGCCTCCTTCTCGAGAAGGAGGCACTGTATATGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043035    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_003982.2-1917s1c1
Sequence:CCGGCAGAACATAAGCGACCGCTTTCTCGAGAAAGCGGTCGCTTATGTTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003982.2-855s1c1
Sequence:CCGGCCTTTGGAGGATTCCTTGCTTCTCGAGAAGCAAGGAATCCTCCAAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043033    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_003982.2-1427s1c1
Sequence:CCGGGCAGATCAGATATTTGGAATACTCGAGTATTCCAAATATCTGATCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043036    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_003982.2-1013s1c1
Sequence:CCGGGCTGCCTGCATTTGTCTCTTACTCGAGTAAGAGACAAATGCAGGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003982
VALIDATED
SLC7A7 MISSION shRNA shRNA Plasmid DNA
solute carrier family 7 (amino acid transporter light chain, y+L system), member 7
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000043034    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_003982.2-712s1c1
Sequence:CCGGGCTCATATACAGTGCCTCCTTCTCGAGAAGGAGGCACTGTATATGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043035    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_003982.2-1917s1c1
Sequence:CCGGCAGAACATAAGCGACCGCTTTCTCGAGAAAGCGGTCGCTTATGTTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003982.2-855s1c1
Sequence:CCGGCCTTTGGAGGATTCCTTGCTTCTCGAGAAGCAAGGAATCCTCCAAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043033    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_003982.2-1427s1c1
Sequence:CCGGGCAGATCAGATATTTGGAATACTCGAGTATTCCAAATATCTGATCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043036    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_003982.2-1013s1c1
Sequence:CCGGGCTGCCTGCATTTGTCTCTTACTCGAGTAAGAGACAAATGCAGGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003982
VALIDATED
SLC7A7 MISSION shRNA Lentiviral Transduction Particles
solute carrier family 7 (amino acid transporter light chain, y+L system), member 7
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000043034    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_003982.2-712s1c1
Sequence:CCGGGCTCATATACAGTGCCTCCTTCTCGAGAAGGAGGCACTGTATATGAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043035    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_003982.2-1917s1c1
Sequence:CCGGCAGAACATAAGCGACCGCTTTCTCGAGAAAGCGGTCGCTTATGTTCTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003982.2-855s1c1
Sequence:CCGGCCTTTGGAGGATTCCTTGCTTCTCGAGAAGCAAGGAATCCTCCAAAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043033    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_003982.2-1427s1c1
Sequence:CCGGGCAGATCAGATATTTGGAATACTCGAGTATTCCAAATATCTGATCTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043036    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_003982.2-1013s1c1
Sequence:CCGGGCTGCCTGCATTTGTCTCTTACTCGAGTAAGAGACAAATGCAGGCAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)