EMAIL THIS PAGE TO A FRIEND

SLC7A9

solute carrier family 7 (amino acid transporter light chain, bo,+ system), member 9

112 Gene Product Result for
Synonyms: BAT1 CSNU3
UniProtKB ID: P82251, B2R9A6
Gene ID:
Human(11136) Summary: This gene encodes a protein that belongs to a family of light subunits of amino acid transporters. This protein plays a role in the high-affinity and sodium-independent transport of cystine and neutral and dibasic amino acids, and appears to function in the reabsorption of cystine in the kidney tubule. Mutations in this gene cause non-type I cystinuria, a disease that leads to cystine stones in the urinary system due to impaired transport of cystine and dibasic amino acids. Alternate transcript variants, which encode the same protein, have been found for this gene. [provided by RefSeq, Jul 2011]
Mouse(30962) solute carrier family 7 (cationic amino acid transporter, y+ system), member 9
Rat(116726) solute carrier family 7 (amino acid transporter light chain, bo,+ system), member 9
Zebrafish(567117) solute carrier family 7 (cationic amino acid transporter, y+ system), member 9
dog(484601) solute carrier family 7 (glycoprotein-associated amino acid transporter light chain, bo,+ system), member 9
domestic cat(101092316) solute carrier family 7 (glycoprotein-associated amino acid transporter light chain, bo,+ system), member 9
Horse(100056073) solute carrier family 7 (glycoprotein-associated amino acid transporter light chain, bo,+ system), member 9
chicken(415768) solute carrier family 7 (glycoprotein-associated amino acid transporter light chain, bo,+ system), member 9
cow(508174) solute carrier family 7 (glycoprotein-associated amino acid transporter light chain, bo,+ system), member 9
sheep(101109558) solute carrier family 7 (glycoprotein-associated amino acid transporter light chain, bo,+ system), member 9
Domestic Rabbit(100008729) solute carrier family 7 (glycoprotein-associated amino acid transporter light chain, bo,+ system), member 9
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021291 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021291 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021291 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014270 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014270 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014270 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001126335 Rosetta Predictions human pricing
NM_014270 Rosetta Predictions human pricing
NM_053929 Rosetta Predictions rat pricing
NM_021291 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001126335 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00328447 predicted 841
2 SASI_Hs02_00328448 predicted 1183
3 SASI_Hs02_00328449 predicted 1345
4 SASI_Hs02_00328450 predicted 1427
5 SASI_Hs02_00328451 predicted 309
6 SASI_Hs02_00328452 predicted 812
7 SASI_Hs02_00328453 predicted 988
8 SASI_Hs02_00328454 predicted 1330
9 SASI_Hs02_00328455 predicted 805
10 SASI_Hs02_00328456 predicted 1352
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014270 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00143787 predicted 927
2 SASI_Hs01_00143789 predicted 1272
3 SASI_Hs01_00143790 predicted 1430
4 SASI_Hs01_00143791 predicted 1514
5 SASI_Hs02_00345338 predicted 396
6 SASI_Hs01_00143792 predicted 905
7 SASI_Hs01_00143793 predicted 1069
8 SASI_Hs01_00143794 predicted 1412
9 SASI_Hs01_00143795 predicted 892
10 SASI_Hs02_00345339 predicted 1444
11 SASI_Hs01_00143788 predicted 291
12 SASI_Hs01_00143796 predicted 249
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053929 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00034088 predicted 545
2 SASI_Rn01_00034089 predicted 964
3 SASI_Rn01_00034091 predicted 510
4 SASI_Rn01_00034092 predicted 1271
5 SASI_Rn01_00034094 predicted 972
6 SASI_Rn01_00034095 predicted 193
7 SASI_Rn01_00034096 predicted 562
8 SASI_Rn01_00034097 predicted 764
9 SASI_Rn02_00266880 predicted 356
10 SASI_Rn02_00266881 predicted 1472
11 SASI_Rn01_00034090 predicted 1352
12 SASI_Rn01_00034093 predicted 688
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021291 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00039588 predicted 1052
2 SASI_Mm01_00039589 predicted 1557
3 SASI_Mm01_00039597 predicted 1089
4 SASI_Mm01_00039590 predicted 1501
5 SASI_Mm01_00039591 predicted 1120
6 SASI_Mm01_00039592 predicted 1036
7 SASI_Mm01_00039593 predicted 843
8 SASI_Mm01_00039594 predicted 1429
9 SASI_Mm01_00039595 predicted 1272
10 SASI_Mm01_00039596 predicted 567
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021291
VALIDATED
SLC7A9 MISSION shRNA Bacterial Glycerol Stock
solute carrier family 7 (amino acid transporter light chain, bo,+ system), member 9
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000079442    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021291.1-581s1c1
Sequence:CCGGGCTTGGCACAATGATTACCAACTCGAGTTGGTAATCATTGTGCCAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000079441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021291.1-1119s1c1
Sequence:CCGGGTATGCTACATCCTCATGAATCTCGAGATTCATGAGGATGTAGCATACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000079439    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021291.1-926s1c1
Sequence:CCGGCCAAGGAAATGTAAAGAACTTCTCGAGAAGTTCTTTACATTTCCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000079440    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021291.1-1566s1c1
Sequence:CCGGCCTATCATTGTGATTCTCGTACTCGAGTACGAGAATCACAATGATAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000079438    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021291.1-1346s1c1
Sequence:CCGGGCTCTCCTACATCAGTGTCAACTCGAGTTGACACTGATGTAGGAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313306    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021291.2-1654s21c1
Sequence:CCGGTCATACTGAGTGGACTTATATCTCGAGATATAAGTCCACTCAGTATGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312343    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021291.2-1346s21c1
Sequence:CCGGGCTCTCCTACATCAGTGTCAACTCGAGTTGACACTGATGTAGGAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313372    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021291.2-1437s21c1
Sequence:CCGGATCAACTCCTTAGTCAATTATCTCGAGATAATTGACTAAGGAGTTGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312342    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021291.2-581s21c1
Sequence:CCGGGCTTGGCACAATGATTACCAACTCGAGTTGGTAATCATTGTGCCAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313370    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021291.2-1027s21c1
Sequence:CCGGGTTGGAACCAACTCAACTATACTCGAGTATAGTTGAGTTGGTTCCAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021291
VALIDATED
SLC7A9 MISSION shRNA shRNA Plasmid DNA
solute carrier family 7 (amino acid transporter light chain, bo,+ system), member 9
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000079442    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021291.1-581s1c1
Sequence:CCGGGCTTGGCACAATGATTACCAACTCGAGTTGGTAATCATTGTGCCAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000079441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021291.1-1119s1c1
Sequence:CCGGGTATGCTACATCCTCATGAATCTCGAGATTCATGAGGATGTAGCATACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000079439    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021291.1-926s1c1
Sequence:CCGGCCAAGGAAATGTAAAGAACTTCTCGAGAAGTTCTTTACATTTCCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000079440    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021291.1-1566s1c1
Sequence:CCGGCCTATCATTGTGATTCTCGTACTCGAGTACGAGAATCACAATGATAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000079438    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021291.1-1346s1c1
Sequence:CCGGGCTCTCCTACATCAGTGTCAACTCGAGTTGACACTGATGTAGGAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313306    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021291.2-1654s21c1
Sequence:CCGGTCATACTGAGTGGACTTATATCTCGAGATATAAGTCCACTCAGTATGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312343    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021291.2-1346s21c1
Sequence:CCGGGCTCTCCTACATCAGTGTCAACTCGAGTTGACACTGATGTAGGAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313372    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021291.2-1437s21c1
Sequence:CCGGATCAACTCCTTAGTCAATTATCTCGAGATAATTGACTAAGGAGTTGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312342    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021291.2-581s21c1
Sequence:CCGGGCTTGGCACAATGATTACCAACTCGAGTTGGTAATCATTGTGCCAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313370    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021291.2-1027s21c1
Sequence:CCGGGTTGGAACCAACTCAACTATACTCGAGTATAGTTGAGTTGGTTCCAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021291
VALIDATED
SLC7A9 MISSION shRNA Lentiviral Transduction Particles
solute carrier family 7 (amino acid transporter light chain, bo,+ system), member 9
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000079442    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021291.1-581s1c1
Sequence:CCGGGCTTGGCACAATGATTACCAACTCGAGTTGGTAATCATTGTGCCAAGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000079441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021291.1-1119s1c1
Sequence:CCGGGTATGCTACATCCTCATGAATCTCGAGATTCATGAGGATGTAGCATACTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000079439    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021291.1-926s1c1
Sequence:CCGGCCAAGGAAATGTAAAGAACTTCTCGAGAAGTTCTTTACATTTCCTTGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000079440    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021291.1-1566s1c1
Sequence:CCGGCCTATCATTGTGATTCTCGTACTCGAGTACGAGAATCACAATGATAGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000079438    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021291.1-1346s1c1
Sequence:CCGGGCTCTCCTACATCAGTGTCAACTCGAGTTGACACTGATGTAGGAGAGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000313306    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021291.2-1654s21c1
Sequence:CCGGTCATACTGAGTGGACTTATATCTCGAGATATAAGTCCACTCAGTATGATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000312343    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021291.2-1346s21c1
Sequence:CCGGGCTCTCCTACATCAGTGTCAACTCGAGTTGACACTGATGTAGGAGAGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000313372    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021291.2-1437s21c1
Sequence:CCGGATCAACTCCTTAGTCAATTATCTCGAGATAATTGACTAAGGAGTTGATTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000312342    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021291.2-581s21c1
Sequence:CCGGGCTTGGCACAATGATTACCAACTCGAGTTGGTAATCATTGTGCCAAGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000313370    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021291.2-1027s21c1
Sequence:CCGGGTTGGAACCAACTCAACTATACTCGAGTATAGTTGAGTTGGTTCCAACTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014270
SLC7A9 MISSION shRNA Bacterial Glycerol Stock
solute carrier family 7 (amino acid transporter light chain, bo,+ system), member 9
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000043079    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014270.1-1594s1c1
Sequence:CCGGCCATGCACCTTCAGATGCTAACTCGAGTTAGCATCTGAAGGTGCATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043078    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014270.1-1287s1c1
Sequence:CCGGCCTGGTGACATAAACTCGTTACTCGAGTAACGAGTTTATGTCACCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014270.1-876s1c1
Sequence:CCGGGCCTATGATGGATGGAATCAACTCGAGTTGATTCCATCCATCATAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043080    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014270.1-926s1c1
Sequence:CCGGCCCTTACAGAAACCTGCCTTTCTCGAGAAAGGCAGGTTTCTGTAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014270.1-1367s1c1
Sequence:CCGGCGTGATGAGATTTACAAGGAACTCGAGTTCCTTGTAAATCTCATCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422037    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014270.4-1423s21c1
Sequence:CCGGTCAAGGTGCCCGTAGTCATTCCTCGAGGAATGACTACGGGCACCTTGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420839    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014270.4-1515s21c1
Sequence:CCGGCTCTACTGTGTGCTGTTTATACTCGAGTATAAACAGCACACAGTAGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419693    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014270.4-1561s21c1
Sequence:CCGGTGTTTGTCCACTACAAGTTTGCTCGAGCAAACTTGTAGTGGACAAACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014270
SLC7A9 MISSION shRNA shRNA Plasmid DNA
solute carrier family 7 (amino acid transporter light chain, bo,+ system), member 9
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000043079    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014270.1-1594s1c1
Sequence:CCGGCCATGCACCTTCAGATGCTAACTCGAGTTAGCATCTGAAGGTGCATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043078    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014270.1-1287s1c1
Sequence:CCGGCCTGGTGACATAAACTCGTTACTCGAGTAACGAGTTTATGTCACCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014270.1-876s1c1
Sequence:CCGGGCCTATGATGGATGGAATCAACTCGAGTTGATTCCATCCATCATAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043080    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014270.1-926s1c1
Sequence:CCGGCCCTTACAGAAACCTGCCTTTCTCGAGAAAGGCAGGTTTCTGTAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014270.1-1367s1c1
Sequence:CCGGCGTGATGAGATTTACAAGGAACTCGAGTTCCTTGTAAATCTCATCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422037    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014270.4-1423s21c1
Sequence:CCGGTCAAGGTGCCCGTAGTCATTCCTCGAGGAATGACTACGGGCACCTTGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420839    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014270.4-1515s21c1
Sequence:CCGGCTCTACTGTGTGCTGTTTATACTCGAGTATAAACAGCACACAGTAGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419693    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014270.4-1561s21c1
Sequence:CCGGTGTTTGTCCACTACAAGTTTGCTCGAGCAAACTTGTAGTGGACAAACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014270
SLC7A9 MISSION shRNA Lentiviral Transduction Particles
solute carrier family 7 (amino acid transporter light chain, bo,+ system), member 9
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000043079    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014270.1-1594s1c1
Sequence:CCGGCCATGCACCTTCAGATGCTAACTCGAGTTAGCATCTGAAGGTGCATGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000043078    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014270.1-1287s1c1
Sequence:CCGGCCTGGTGACATAAACTCGTTACTCGAGTAACGAGTTTATGTCACCAGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000043082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014270.1-876s1c1
Sequence:CCGGGCCTATGATGGATGGAATCAACTCGAGTTGATTCCATCCATCATAGGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000043080    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014270.1-926s1c1
Sequence:CCGGCCCTTACAGAAACCTGCCTTTCTCGAGAAAGGCAGGTTTCTGTAAGGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000043081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014270.1-1367s1c1
Sequence:CCGGCGTGATGAGATTTACAAGGAACTCGAGTTCCTTGTAAATCTCATCACGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000422037    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014270.4-1423s21c1
Sequence:CCGGTCAAGGTGCCCGTAGTCATTCCTCGAGGAATGACTACGGGCACCTTGATTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000420839    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014270.4-1515s21c1
Sequence:CCGGCTCTACTGTGTGCTGTTTATACTCGAGTATAAACAGCACACAGTAGAGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000419693    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014270.4-1561s21c1
Sequence:CCGGTGTTTGTCCACTACAAGTTTGCTCGAGCAAACTTGTAGTGGACAAACATTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???