EMAIL THIS PAGE TO A FRIEND

SLC9A1

solute carrier family 9, subfamily A (NHE1, cation proton antiporter 1), member 1

109 Gene Product Result for
Synonyms: APNH NHE-1 NHE1
UniProtKB ID: P19634, B1ALD6, D3DPL4, Q96EM2
Gene ID:
Human(6548) Summary: This gene encodes a Na+/H+ antiporter that is a member of the solute carrier family 9. The encoded protein is a plasma membrane transporter that is expressed in the kidney and intestine. This protein plays a central role in regulating pH homeostasis, cell migration and cell volume. This protein may also be involved in tumor growth. [provided by RefSeq, Sep 2011]
Mouse(20544) solute carrier family 9 (sodium/hydrogen exchanger), member 1
Rat(24782) solute carrier family 9, subfamily A (NHE1, cation proton antiporter 1), member 1
cow(317654) solute carrier family 9 (sodium/hydrogen exchanger), member 1
sheep(494435) solute carrier family 9, subfamily A (NHE1, cation proton antiporter 1), member 1
domestic guinea pig(100712925) solute carrier family 9, subfamily A (NHE1, cation proton antiporter 1), member 1
Domestic Rabbit(100009586) solute carrier family 9, subfamily A (NHE1, cation proton antiporter 1), member 1
naked mole-rat(101724784) solute carrier family 9, subfamily A (NHE1, cation proton antiporter 1), member 1
Zebrafish(795135) solute carrier family 9 (sodium/hydrogen exchanger), member 1
chicken(419580) solute carrier family 9, subfamily A (NHE1, cation proton antiporter 1), member 1
dog(478171) solute carrier family 9, subfamily A (NHE1, cation proton antiporter 1), member 1
Horse(100070959) solute carrier family 9, subfamily A (NHE1, cation proton antiporter 1), member 1
domestic cat(101088766) solute carrier family 9, subfamily A (NHE1, cation proton antiporter 1), member 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AB3081 Anti-Na+/H+ Exchanger-1 Antibody Detect Na+/H+ Exchanger-1 using this Anti-Na+/H+ Exchanger-1 Antibody validated for use in ELISA & WB. ELISA, ELISA: suitable, western blot, western blot: suitable pricing
MAB3140 Anti-Na+/H+ Exchanger-1 Antibody, CT, clone 4E9 Anti-Na+/H+ Exchanger-1 Antibody, C-terminus, clone 4E9 detects level of Na+/H+ Exchanger-1 & has been published & validated for use in WB. western blot, western blot: suitable pricing
PRS4377 Anti-Nhe-1 (ab1) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution rat, human, mouse
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
PRS4379 Anti-Nhe-1 (ab2) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution mouse, rat, human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB4200016 Anti-SLC9A1 antibody produced in rabbit ~1.0 mg/mL, affinity isolated antibody, buffered aqueous solution human
western blot pricing
HPA048532 Anti-SLC9A1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution Antibody Enhanced Validation human
immunohistochemistry pricing
HPA052891 Anti-SLC9A1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution Antibody Enhanced Validation human
immunofluorescence, immunohistochemistry pricing
WH0006548M1 Monoclonal Anti-SLC9A1 antibody produced in mouse clone 2F5, purified immunoglobulin, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing

Small Molecule - Antagonist

Product # Description Species Add to Cart
 
K4389 KR-32568 ≥98% (HPLC), solid human pricing
C4522 Cimetidine human, mouse, rat pricing
51330 Harmaline ≥95% human, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016981 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_016981 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_016981 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003047 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003047 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003047 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003047 Rosetta Predictions human pricing
NM_012652 Rosetta Predictions rat pricing
NM_016981 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003047 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00025997 predicted 1307
2 SASI_Hs01_00025998 predicted 792
3 SASI_Hs01_00025999 predicted 3352
4 SASI_Hs01_00026000 predicted 2853
5 SASI_Hs01_00026001 predicted 2143
6 SASI_Hs01_00026002 predicted 3348
7 SASI_Hs01_00026003 predicted 1307
8 SASI_Hs01_00026004 predicted 1401
9 SASI_Hs01_00026005 predicted 3431
10 SASI_Hs01_00026006 predicted 2042
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012652 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00050823 predicted 2235
2 SASI_Rn01_00050824 predicted 1607
3 SASI_Rn01_00050825 predicted 3239
4 SASI_Rn01_00050826 predicted 2438
5 SASI_Rn02_00259901 predicted 2303
6 SASI_Rn01_00050827 predicted 978
7 SASI_Rn01_00050828 predicted 788
8 SASI_Rn01_00050829 predicted 1050
9 SASI_Rn01_00050830 predicted 1048
10 SASI_Rn01_00050831 predicted 2446
11 SASI_Rn01_00050832 predicted 992
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016981 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00060494 predicted 1593
2 SASI_Mm01_00060495 predicted 2395
3 SASI_Mm02_00323836 predicted 1002
4 SASI_Mm01_00060496 predicted 987
5 SASI_Mm01_00060497 predicted 2318
6 SASI_Mm01_00060498 predicted 2458
7 SASI_Mm01_00060499 predicted 1609
8 SASI_Mm01_00060500 predicted 1627
9 SASI_Mm02_00323837 predicted 1729
10 SASI_Mm01_00060502 predicted 2898
11 SASI_Mm01_00060501 predicted 1773
12 SASI_Mm01_00060503 predicted 533
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016981
VALIDATED
SLC9A1 MISSION shRNA Bacterial Glycerol Stock
solute carrier family 9, subfamily A (NHE1, cation proton antiporter 1), member 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000317401    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016981.2-2452s21c1
Sequence:CCGGGTATGTGAAGAAGTGCCTGATCTCGAGATCAGGCACTTCTTCACATACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313883    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016981.2-1732s21c1
Sequence:CCGGAGCTTTCACCTCCCGATTTACCTCGAGGTAAATCGGGAGGTGAAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317467    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016981.2-2329s21c1
Sequence:CCGGGCGCTCCATCAACGAGGAGATCTCGAGATCTCCTCGTTGATGGAGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313951    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016981.2-993s21c1
Sequence:CCGGACCACAATTTGACCAACTTAACTCGAGTTAAGTTGGTCAAATTGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313884    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016981.2-3554s21c1
Sequence:CCGGCTCCATCCTTGATCATCATTTCTCGAGAAATGATGATCAAGGATGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016981.1-537s1c1
Sequence:CCGGCCACAATTTGACCAACTTAATCTCGAGATTAAGTTGGTCAAATTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016981.1-1332s1c1
Sequence:CCGGCCTCTACAGCTACATGGCTTACTCGAGTAAGCCATGTAGCTGTAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016981.1-792s1c1
Sequence:CCGGCCTGCAATCAGACGTCTTCTTCTCGAGAAGAAGACGTCTGATTGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016981.1-1872s1c1
Sequence:CCGGGCGCTCCATCAACGAGGAGATCTCGAGATCTCCTCGTTGATGGAGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068550    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016981.1-1995s1c1
Sequence:CCGGGTATGTGAAGAAGTGCCTGATCTCGAGATCAGGCACTTCTTCACATACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016981
VALIDATED
SLC9A1 MISSION shRNA shRNA Plasmid DNA
solute carrier family 9, subfamily A (NHE1, cation proton antiporter 1), member 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000317401    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016981.2-2452s21c1
Sequence:CCGGGTATGTGAAGAAGTGCCTGATCTCGAGATCAGGCACTTCTTCACATACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313883    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016981.2-1732s21c1
Sequence:CCGGAGCTTTCACCTCCCGATTTACCTCGAGGTAAATCGGGAGGTGAAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000317467    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016981.2-2329s21c1
Sequence:CCGGGCGCTCCATCAACGAGGAGATCTCGAGATCTCCTCGTTGATGGAGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313951    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016981.2-993s21c1
Sequence:CCGGACCACAATTTGACCAACTTAACTCGAGTTAAGTTGGTCAAATTGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313884    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016981.2-3554s21c1
Sequence:CCGGCTCCATCCTTGATCATCATTTCTCGAGAAATGATGATCAAGGATGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016981.1-537s1c1
Sequence:CCGGCCACAATTTGACCAACTTAATCTCGAGATTAAGTTGGTCAAATTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016981.1-1332s1c1
Sequence:CCGGCCTCTACAGCTACATGGCTTACTCGAGTAAGCCATGTAGCTGTAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016981.1-792s1c1
Sequence:CCGGCCTGCAATCAGACGTCTTCTTCTCGAGAAGAAGACGTCTGATTGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016981.1-1872s1c1
Sequence:CCGGGCGCTCCATCAACGAGGAGATCTCGAGATCTCCTCGTTGATGGAGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068550    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016981.1-1995s1c1
Sequence:CCGGGTATGTGAAGAAGTGCCTGATCTCGAGATCAGGCACTTCTTCACATACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016981
VALIDATED
SLC9A1 MISSION shRNA Lentiviral Transduction Particles
solute carrier family 9, subfamily A (NHE1, cation proton antiporter 1), member 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000317401    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016981.2-2452s21c1
Sequence:CCGGGTATGTGAAGAAGTGCCTGATCTCGAGATCAGGCACTTCTTCACATACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313883    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016981.2-1732s21c1
Sequence:CCGGAGCTTTCACCTCCCGATTTACCTCGAGGTAAATCGGGAGGTGAAAGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000317467    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016981.2-2329s21c1
Sequence:CCGGGCGCTCCATCAACGAGGAGATCTCGAGATCTCCTCGTTGATGGAGCGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313951    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016981.2-993s21c1
Sequence:CCGGACCACAATTTGACCAACTTAACTCGAGTTAAGTTGGTCAAATTGTGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313884    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016981.2-3554s21c1
Sequence:CCGGCTCCATCCTTGATCATCATTTCTCGAGAAATGATGATCAAGGATGGAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016981.1-537s1c1
Sequence:CCGGCCACAATTTGACCAACTTAATCTCGAGATTAAGTTGGTCAAATTGTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016981.1-1332s1c1
Sequence:CCGGCCTCTACAGCTACATGGCTTACTCGAGTAAGCCATGTAGCTGTAGAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016981.1-792s1c1
Sequence:CCGGCCTGCAATCAGACGTCTTCTTCTCGAGAAGAAGACGTCTGATTGCAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016981.1-1872s1c1
Sequence:CCGGGCGCTCCATCAACGAGGAGATCTCGAGATCTCCTCGTTGATGGAGCGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068550    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016981.1-1995s1c1
Sequence:CCGGGTATGTGAAGAAGTGCCTGATCTCGAGATCAGGCACTTCTTCACATACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003047
VALIDATED
SLC9A1 MISSION shRNA Bacterial Glycerol Stock
solute carrier family 9, subfamily A (NHE1, cation proton antiporter 1), member 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000290619    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_003047.3-3409s21c1
Sequence:CCGGCCAATCTTAGTTTCTAACCAACTCGAGTTGGTTAGAAACTAAGATTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290555    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_003047.3-663s21c1
Sequence:CCGGCATCGGATCTTCCCTTCCTTACTCGAGTAAGGAAGGGAAGATCCGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290557    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_003047.3-1271s21c1
Sequence:CCGGCGGTGAGCAGATCAACAACATCTCGAGATGTTGTTGATCTGCTCACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296655    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_003047.3-2268s21c1
Sequence:CCGGGACAAGCTCAACCGGTTTAATCTCGAGATTAAACCGGTTGAGCTTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296717    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003047.3-1574s21c1
Sequence:CCGGAGCCTTCACCTCCCGATTTACCTCGAGGTAAATCGGGAGGTGAAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044649    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_003047.2-1222s1c1
Sequence:CCGGCGGTGAGCAGATCAACAACATCTCGAGATGTTGTTGATCTGCTCACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044650    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_003047.2-1870s1c1
Sequence:CCGGCCTGACCTGGTTCATCAACAACTCGAGTTGTTGATGAACCAGGTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044648    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_003047.2-3360s1c1
Sequence:CCGGCCAATCTTAGTTTCTAACCAACTCGAGTTGGTTAGAAACTAAGATTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044652    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_003047.2-1379s1c1
Sequence:CCGGGCCGTCACTGTGGTCCTGTATCTCGAGATACAGGACCACAGTGACGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044651    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_003047.2-614s1c1
Sequence:CCGGCATCGGATCTTCCCTTCCTTACTCGAGTAAGGAAGGGAAGATCCGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003047
VALIDATED
SLC9A1 MISSION shRNA shRNA Plasmid DNA
solute carrier family 9, subfamily A (NHE1, cation proton antiporter 1), member 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000290619    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_003047.3-3409s21c1
Sequence:CCGGCCAATCTTAGTTTCTAACCAACTCGAGTTGGTTAGAAACTAAGATTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000290555    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_003047.3-663s21c1
Sequence:CCGGCATCGGATCTTCCCTTCCTTACTCGAGTAAGGAAGGGAAGATCCGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000290557    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_003047.3-1271s21c1
Sequence:CCGGCGGTGAGCAGATCAACAACATCTCGAGATGTTGTTGATCTGCTCACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296655    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_003047.3-2268s21c1
Sequence:CCGGGACAAGCTCAACCGGTTTAATCTCGAGATTAAACCGGTTGAGCTTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296717    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003047.3-1574s21c1
Sequence:CCGGAGCCTTCACCTCCCGATTTACCTCGAGGTAAATCGGGAGGTGAAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044649    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_003047.2-1222s1c1
Sequence:CCGGCGGTGAGCAGATCAACAACATCTCGAGATGTTGTTGATCTGCTCACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044650    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_003047.2-1870s1c1
Sequence:CCGGCCTGACCTGGTTCATCAACAACTCGAGTTGTTGATGAACCAGGTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044648    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_003047.2-3360s1c1
Sequence:CCGGCCAATCTTAGTTTCTAACCAACTCGAGTTGGTTAGAAACTAAGATTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044652    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_003047.2-1379s1c1
Sequence:CCGGGCCGTCACTGTGGTCCTGTATCTCGAGATACAGGACCACAGTGACGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044651    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_003047.2-614s1c1
Sequence:CCGGCATCGGATCTTCCCTTCCTTACTCGAGTAAGGAAGGGAAGATCCGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003047
VALIDATED
SLC9A1 MISSION shRNA Lentiviral Transduction Particles
solute carrier family 9, subfamily A (NHE1, cation proton antiporter 1), member 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000290619    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_003047.3-3409s21c1
Sequence:CCGGCCAATCTTAGTTTCTAACCAACTCGAGTTGGTTAGAAACTAAGATTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000290555    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_003047.3-663s21c1
Sequence:CCGGCATCGGATCTTCCCTTCCTTACTCGAGTAAGGAAGGGAAGATCCGATGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000290557    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_003047.3-1271s21c1
Sequence:CCGGCGGTGAGCAGATCAACAACATCTCGAGATGTTGTTGATCTGCTCACCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296655    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_003047.3-2268s21c1
Sequence:CCGGGACAAGCTCAACCGGTTTAATCTCGAGATTAAACCGGTTGAGCTTGTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296717    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003047.3-1574s21c1
Sequence:CCGGAGCCTTCACCTCCCGATTTACCTCGAGGTAAATCGGGAGGTGAAGGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044649    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_003047.2-1222s1c1
Sequence:CCGGCGGTGAGCAGATCAACAACATCTCGAGATGTTGTTGATCTGCTCACCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044650    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_003047.2-1870s1c1
Sequence:CCGGCCTGACCTGGTTCATCAACAACTCGAGTTGTTGATGAACCAGGTCAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044648    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_003047.2-3360s1c1
Sequence:CCGGCCAATCTTAGTTTCTAACCAACTCGAGTTGGTTAGAAACTAAGATTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044652    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_003047.2-1379s1c1
Sequence:CCGGGCCGTCACTGTGGTCCTGTATCTCGAGATACAGGACCACAGTGACGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044651    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_003047.2-614s1c1
Sequence:CCGGCATCGGATCTTCCCTTCCTTACTCGAGTAAGGAAGGGAAGATCCGATGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)