EMAIL THIS PAGE TO A FRIEND

SLC9A2

solute carrier family 9, subfamily A (NHE2, cation proton antiporter 2), member 2

100 Gene Product Result for
Synonyms: NHE2
UniProtKB ID: Q9UBY0, B2RMS2
Gene ID:
Mouse(226999) solute carrier family 9 (sodium/hydrogen exchanger), member 2
Rat(24783) solute carrier family 9, subfamily A (NHE2, cation proton antiporter 2), member 2
cow(526134) solute carrier family 9, subfamily A (NHE2, cation proton antiporter 2), member 2
sheep(101108738) solute carrier family 9, subfamily A (NHE2, cation proton antiporter 2), member 2
naked mole-rat(101714133) solute carrier family 9, subfamily A (NHE2, cation proton antiporter 2), member 2
Domestic Rabbit(100343957) solute carrier family 9, subfamily A (NHE2, cation proton antiporter 2), member 2
domestic guinea pig(100727124) solute carrier family 9, subfamily A (NHE2, cation proton antiporter 2), member 2
Zebrafish(562904) solute carrier family 9 (sodium/hydrogen exchanger), member 2
Horse(100034108) solute carrier family 9, subfamily A (NHE2, cation proton antiporter 2), member 2
domestic cat(101084614) solute carrier family 9, subfamily A (NHE2, cation proton antiporter 2), member 2
dog(474546) solute carrier family 9, subfamily A (NHE2, cation proton antiporter 2), member 2
chicken(418719) solute carrier family 9, subfamily A (NHE2, cation proton antiporter 2), member 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Antagonist

Product # Description Species Add to Cart
 
A4562 5-(N,N-Dimethyl)amiloride hydrochloride human, mouse, rat pricing
A3085 5-(N-Ethyl-N-isopropyl)amiloride human, mouse, rat pricing
C4522 Cimetidine human, mouse, rat pricing
51330 Harmaline ≥95% human, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_129721 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_129721 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_129721 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003048 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003048 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003048 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU186521 MISSION® esiRNA esiRNA targeting mouse Slc9a2 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003048 Rosetta Predictions human pricing
NM_001113335 Rosetta Predictions rat pricing
NM_012653 Rosetta Predictions rat pricing
NM_001033289 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003048 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00073551 predicted 2184
2 SASI_Hs01_00073553 predicted 422
3 SASI_Hs01_00073554 predicted 1937
4 SASI_Hs01_00073555 predicted 929
5 SASI_Hs01_00073556 predicted 1597
6 SASI_Hs01_00073557 predicted 1379
7 SASI_Hs01_00073558 predicted 2048
8 SASI_Hs01_00073559 predicted 1565
9 SASI_Hs01_00073560 predicted 947
10 SASI_Hs02_00334959 predicted 883
11 SASI_Hs01_00073552 predicted 2128
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001113335 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00251723 predicted 2275
2 SASI_Rn02_00251724 predicted 1999
3 SASI_Rn02_00251725 predicted 2049
4 SASI_Rn02_00251726 predicted 2166
5 SASI_Rn02_00251727 predicted 1747
6 SASI_Rn02_00251728 predicted 1459
7 SASI_Rn02_00251729 predicted 1583
8 SASI_Rn02_00251730 predicted 1786
9 SASI_Rn02_00251731 predicted 871
10 SASI_Rn02_00251732 predicted 1096
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012653 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00259902 predicted 2277
2 SASI_Rn01_00072758 predicted 2002
3 SASI_Rn01_00072760 predicted 2043
4 SASI_Rn01_00072763 predicted 2162
5 SASI_Rn02_00259903 predicted 1749
6 SASI_Rn01_00072765 predicted 1454
7 SASI_Rn01_00072766 predicted 1584
8 SASI_Rn02_00259904 predicted 1783
9 SASI_Rn02_00259905 predicted 864
10 SASI_Rn02_00259906 predicted 1084
11 SASI_Rn01_00072759 predicted 2640
12 SASI_Rn01_00072761 predicted 566
13 SASI_Rn01_00072762 predicted 558
14 SASI_Rn01_00072764 predicted 1996
15 SASI_Rn01_00072767 predicted 2094
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033289 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00156824 predicted 2308
2 SASI_Mm01_00156825 predicted 1977
3 SASI_Mm01_00156826 predicted 1077
4 SASI_Mm01_00156827 predicted 2146
5 SASI_Mm01_00156828 predicted 528
6 SASI_Mm01_00156829 predicted 514
7 SASI_Mm01_00156830 predicted 1044
8 SASI_Mm01_00156831 predicted 2025
9 SASI_Mm01_00156832 predicted 1066
10 SASI_Mm01_00156833 predicted 2067
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_129721
SLC9A2 MISSION shRNA Bacterial Glycerol Stock
solute carrier family 9, subfamily A (NHE2, cation proton antiporter 2), member 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000068789    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_129721.4-1637s1c1
Sequence:CCGGCGGCTGCTATTGTCGTTATATCTCGAGATATAACGACAATAGCAGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_129721.4-1264s1c1
Sequence:CCGGGCGTGTGCCATGACAATGAATCTCGAGATTCATTGTCATGGCACACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_129721.4-2247s1c1
Sequence:CCGGCCGATATTTATCCTTACCTAACTCGAGTTAGGTAAGGATAAATATCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068790    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_129721.4-2035s1c1
Sequence:CCGGCCAGGCGAAATGGATGAAATTCTCGAGAATTTCATCCATTTCGCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068791    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_129721.4-2398s1c1
Sequence:CCGGCCAGATCAGTTCTCAAAGAAACTCGAGTTTCTTTGAGAACTGATCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_129721
SLC9A2 MISSION shRNA shRNA Plasmid DNA
solute carrier family 9, subfamily A (NHE2, cation proton antiporter 2), member 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000068789    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_129721.4-1637s1c1
Sequence:CCGGCGGCTGCTATTGTCGTTATATCTCGAGATATAACGACAATAGCAGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_129721.4-1264s1c1
Sequence:CCGGGCGTGTGCCATGACAATGAATCTCGAGATTCATTGTCATGGCACACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_129721.4-2247s1c1
Sequence:CCGGCCGATATTTATCCTTACCTAACTCGAGTTAGGTAAGGATAAATATCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068790    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_129721.4-2035s1c1
Sequence:CCGGCCAGGCGAAATGGATGAAATTCTCGAGAATTTCATCCATTTCGCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068791    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_129721.4-2398s1c1
Sequence:CCGGCCAGATCAGTTCTCAAAGAAACTCGAGTTTCTTTGAGAACTGATCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_129721
SLC9A2 MISSION shRNA Lentiviral Transduction Particles
solute carrier family 9, subfamily A (NHE2, cation proton antiporter 2), member 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000068789    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_129721.4-1637s1c1
Sequence:CCGGCGGCTGCTATTGTCGTTATATCTCGAGATATAACGACAATAGCAGCCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_129721.4-1264s1c1
Sequence:CCGGGCGTGTGCCATGACAATGAATCTCGAGATTCATTGTCATGGCACACGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_129721.4-2247s1c1
Sequence:CCGGCCGATATTTATCCTTACCTAACTCGAGTTAGGTAAGGATAAATATCGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068790    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_129721.4-2035s1c1
Sequence:CCGGCCAGGCGAAATGGATGAAATTCTCGAGAATTTCATCCATTTCGCCTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068791    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_129721.4-2398s1c1
Sequence:CCGGCCAGATCAGTTCTCAAAGAAACTCGAGTTTCTTTGAGAACTGATCTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003048
VALIDATED
SLC9A2 MISSION shRNA Bacterial Glycerol Stock
solute carrier family 9, subfamily A (NHE2, cation proton antiporter 2), member 2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000005740    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_003048.3-620s1c1
Sequence:CCGGCGCCCATTCTTTGAGAACATTCTCGAGAATGTTCTCAAAGAATGGGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005741    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_003048.3-870s1c1
Sequence:CCGGCCCTGCTGAATGATGCAGTAACTCGAGTTACTGCATCATTCAGCAGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005739    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_003048.3-2717s1c1
Sequence:CCGGCCACGGATAAATGAGGCAAATCTCGAGATTTGCCTCATTTATCCGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005742    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_003048.3-1946s1c1
Sequence:CCGGCGAGAACTCTTATCAAGAAATCTCGAGATTTCTTGATAAGAGTTCTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003048.3-346s1c1
Sequence:CCGGGCCTGTGTTTACGCTGGATTACTCGAGTAATCCAGCGTAAACACAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436010    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003048.3-1779s21c1
Sequence:CCGGACCAACCAAAGTCAAGTATTGCTCGAGCAATACTTGACTTTGGTTGGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419888    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003048.3-1039s21c1
Sequence:CCGGTACTCGATTCACCCATAATATCTCGAGATATTATGGGTGAATCGAGTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424910    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003048.3-2062s21c1
Sequence:CCGGGCGACACAGTTTGCGAGAAAGCTCGAGCTTTCTCGCAAACTGTGTCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003048
VALIDATED
SLC9A2 MISSION shRNA shRNA Plasmid DNA
solute carrier family 9, subfamily A (NHE2, cation proton antiporter 2), member 2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000005740    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_003048.3-620s1c1
Sequence:CCGGCGCCCATTCTTTGAGAACATTCTCGAGAATGTTCTCAAAGAATGGGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005741    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_003048.3-870s1c1
Sequence:CCGGCCCTGCTGAATGATGCAGTAACTCGAGTTACTGCATCATTCAGCAGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005739    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_003048.3-2717s1c1
Sequence:CCGGCCACGGATAAATGAGGCAAATCTCGAGATTTGCCTCATTTATCCGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005742    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_003048.3-1946s1c1
Sequence:CCGGCGAGAACTCTTATCAAGAAATCTCGAGATTTCTTGATAAGAGTTCTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003048.3-346s1c1
Sequence:CCGGGCCTGTGTTTACGCTGGATTACTCGAGTAATCCAGCGTAAACACAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000436010    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003048.3-1779s21c1
Sequence:CCGGACCAACCAAAGTCAAGTATTGCTCGAGCAATACTTGACTTTGGTTGGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419888    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003048.3-1039s21c1
Sequence:CCGGTACTCGATTCACCCATAATATCTCGAGATATTATGGGTGAATCGAGTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424910    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003048.3-2062s21c1
Sequence:CCGGGCGACACAGTTTGCGAGAAAGCTCGAGCTTTCTCGCAAACTGTGTCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003048
VALIDATED
SLC9A2 MISSION shRNA Lentiviral Transduction Particles
solute carrier family 9, subfamily A (NHE2, cation proton antiporter 2), member 2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000005740    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_003048.3-620s1c1
Sequence:CCGGCGCCCATTCTTTGAGAACATTCTCGAGAATGTTCTCAAAGAATGGGCGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005741    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_003048.3-870s1c1
Sequence:CCGGCCCTGCTGAATGATGCAGTAACTCGAGTTACTGCATCATTCAGCAGGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005739    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_003048.3-2717s1c1
Sequence:CCGGCCACGGATAAATGAGGCAAATCTCGAGATTTGCCTCATTTATCCGTGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005742    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_003048.3-1946s1c1
Sequence:CCGGCGAGAACTCTTATCAAGAAATCTCGAGATTTCTTGATAAGAGTTCTCGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003048.3-346s1c1
Sequence:CCGGGCCTGTGTTTACGCTGGATTACTCGAGTAATCCAGCGTAAACACAGGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000436010    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003048.3-1779s21c1
Sequence:CCGGACCAACCAAAGTCAAGTATTGCTCGAGCAATACTTGACTTTGGTTGGTTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419888    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003048.3-1039s21c1
Sequence:CCGGTACTCGATTCACCCATAATATCTCGAGATATTATGGGTGAATCGAGTATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424910    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003048.3-2062s21c1
Sequence:CCGGGCGACACAGTTTGCGAGAAAGCTCGAGCTTTCTCGCAAACTGTGTCGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)