EMAIL THIS PAGE TO A FRIEND

SLC9A3

solute carrier family 9, subfamily A (NHE3, cation proton antiporter 3), member 3

65 Gene Product Result for
Synonyms: NHE3
UniProtKB ID: P48764, Q3MIW3
Gene ID:
Mouse(105243) solute carrier family 9 (sodium/hydrogen exchanger), member 3
Rat(24784) solute carrier family 9, subfamily A (NHE3, cation proton antiporter 3), member 3
chicken(420801) solute carrier family 9, subfamily A (NHE3, cation proton antiporter 3), member 3
Horse(100034109) solute carrier family 9, subfamily A (NHE3, cation proton antiporter 3), member 3
domestic cat(101082470) solute carrier family 9, subfamily A (NHE3, cation proton antiporter 3), member 3
dog(488073) solute carrier family 9 (sodium/hydrogen exchanger), member 3
domestic guinea pig(100734952) solute carrier family 9, subfamily A (NHE3, cation proton antiporter 3), member 3
naked mole-rat(101700748) solute carrier family 9, subfamily A (NHE3, cation proton antiporter 3), member 3
cow(407112) solute carrier family 9 (sodium/hydrogen exchanger), member 3
sheep(494437) solute carrier family 9, subfamily A (NHE3, cation proton antiporter 3), member 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Antagonist

Product # Description Species Add to Cart
 
A4562 5-(N,N-Dimethyl)amiloride hydrochloride human, mouse, rat pricing
A9561 5-(N,N-Hexamethylene)amiloride human, mouse, rat pricing
A3085 5-(N-Ethyl-N-isopropyl)amiloride human, mouse, rat pricing
C4522 Cimetidine human, mouse, rat pricing
51330 Harmaline ≥95% human, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001081060 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081060 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081060 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004174 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004174 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004174 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU149191 MISSION® esiRNA targeting human SLC9A3 human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004174 Rosetta Predictions human pricing
NM_012654 Rosetta Predictions rat pricing
XM_579341 Rosetta Predictions rat pricing
NM_001081060 Rosetta Predictions mouse pricing
XM_127434 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004174 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00066248 predicted 1322 154.00
2 SASI_Hs01_00066249 predicted 2139 154.00
3 SASI_Hs01_00066250 predicted 838 154.00
4 SASI_Hs01_00066251 predicted 1863 154.00
5 SASI_Hs01_00066252 predicted 1417 154.00
6 SASI_Hs01_00066253 predicted 1778 154.00
7 SASI_Hs01_00066254 predicted 1063 154.00
8 SASI_Hs02_00337056 predicted 2220 154.00
9 SASI_Hs01_00066255 predicted 1298 154.00
10 SASI_Hs01_00066256 predicted 2203 154.00
11 SASI_Hs01_00066247 predicted 1703 154.00
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012654 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00116103 predicted 1284 154.00
2 SASI_Rn01_00116104 predicted 205 154.00
3 SASI_Rn01_00116105 predicted 2148 154.00
4 SASI_Rn01_00116106 predicted 2216 154.00
5 SASI_Rn01_00116107 predicted 1827 154.00
6 SASI_Rn01_00116109 predicted 766 154.00
7 SASI_Rn01_00116110 predicted 1558 154.00
8 SASI_Rn01_00116111 predicted 1584 154.00
9 SASI_Rn01_00116112 predicted 1634 154.00
10 SASI_Rn02_00259907 predicted 2080 154.00
11 SASI_Rn01_00116108 predicted 554 154.00
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579341 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00193020 predicted 1284 154.00
2 SASI_Rn01_00193021 predicted 2150 154.00
3 SASI_Rn01_00193022 predicted 2217 154.00
4 SASI_Rn01_00193023 predicted 1836 154.00
5 SASI_Rn01_00193024 predicted 766 154.00
6 SASI_Rn01_00193025 predicted 1566 154.00
7 SASI_Rn01_00193026 predicted 1568 154.00
8 SASI_Rn01_00193027 predicted 1586 154.00
9 SASI_Rn01_00193028 predicted 1637 154.00
10 SASI_Rn01_00193029 predicted 2078 154.00
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081060 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00294781 predicted 460 154.00
2 SASI_Mm02_00294782 predicted 1682 154.00
3 SASI_Mm02_00294783 predicted 421 154.00
4 SASI_Mm02_00294784 predicted 1473 154.00
5 SASI_Mm02_00294785 predicted 1463 154.00
6 SASI_Mm02_00294786 predicted 1979 154.00
7 SASI_Mm02_00294787 predicted 1532 154.00
8 SASI_Mm02_00294788 predicted 1488 154.00
9 SASI_Mm02_00294789 predicted 2114 154.00
10 SASI_Mm02_00294790 predicted 1457 154.00
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_127434 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00273140 predicted 459 154.00
2 SASI_Mm01_00273141 predicted 495 154.00
3 SASI_Mm01_00273142 predicted 701 154.00
4 SASI_Mm01_00273143 predicted 651 154.00
5 SASI_Mm01_00273144 predicted 654 154.00
6 SASI_Mm01_00273145 predicted 589 154.00
7 SASI_Mm01_00273146 predicted 822 154.00
8 SASI_Mm01_00273147 predicted 206 154.00
9 SASI_Mm01_00273148 predicted 687 154.00
10 SASI_Mm01_00273149 predicted 430 154.00
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081060
SLC9A3 MISSION shRNA Bacterial Glycerol Stock
solute carrier family 9, subfamily A (NHE3, cation proton antiporter 3), member 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000251710    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081060.1-1494s21c1
Sequence:CCGGCAGAGATAAGTGGTCCAATTTCTCGAGAAATTGGACCACTTATCTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251711    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081060.1-1336s21c1
Sequence:CCGGTTTCAGGGCCTGACCATTAAGCTCGAGCTTAATGGTCAGGCCCTGAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000267394    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081060.1-1015s21c1
Sequence:CCGGAGTGGAGCAGAGACCATTATCCTCGAGGATAATGGTCTCTGCTCCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251709    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081060.1-422s21c1
Sequence:CCGGATGCTGTCATTGGCACTATATCTCGAGATATAGTGCCAATGACAGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251712    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081060.1-1673s21c1
Sequence:CCGGGTACGGACAATATGGTCAATGCTCGAGCATTGACCATATTGTCCGTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081060
SLC9A3 MISSION shRNA shRNA Plasmid DNA
solute carrier family 9, subfamily A (NHE3, cation proton antiporter 3), member 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000251710    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081060.1-1494s21c1
Sequence:CCGGCAGAGATAAGTGGTCCAATTTCTCGAGAAATTGGACCACTTATCTCTGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000251711    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081060.1-1336s21c1
Sequence:CCGGTTTCAGGGCCTGACCATTAAGCTCGAGCTTAATGGTCAGGCCCTGAAATTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000267394    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081060.1-1015s21c1
Sequence:CCGGAGTGGAGCAGAGACCATTATCCTCGAGGATAATGGTCTCTGCTCCACTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000251709    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081060.1-422s21c1
Sequence:CCGGATGCTGTCATTGGCACTATATCTCGAGATATAGTGCCAATGACAGCATTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000251712    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081060.1-1673s21c1
Sequence:CCGGGTACGGACAATATGGTCAATGCTCGAGCATTGACCATATTGTCCGTACTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081060
SLC9A3 MISSION shRNA Lentiviral Transduction Particles
solute carrier family 9, subfamily A (NHE3, cation proton antiporter 3), member 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000251710    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081060.1-1494s21c1
Sequence:CCGGCAGAGATAAGTGGTCCAATTTCTCGAGAAATTGGACCACTTATCTCTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251711    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081060.1-1336s21c1
Sequence:CCGGTTTCAGGGCCTGACCATTAAGCTCGAGCTTAATGGTCAGGCCCTGAAATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000267394    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081060.1-1015s21c1
Sequence:CCGGAGTGGAGCAGAGACCATTATCCTCGAGGATAATGGTCTCTGCTCCACTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251709    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081060.1-422s21c1
Sequence:CCGGATGCTGTCATTGGCACTATATCTCGAGATATAGTGCCAATGACAGCATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251712    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081060.1-1673s21c1
Sequence:CCGGGTACGGACAATATGGTCAATGCTCGAGCATTGACCATATTGTCCGTACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004174
SLC9A3 MISSION shRNA Bacterial Glycerol Stock
solute carrier family 9, subfamily A (NHE3, cation proton antiporter 3), member 3
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000044703    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004174.1-1048s1c1
Sequence:CCGGCGAGACCATCATCTTCATGTTCTCGAGAACATGAAGATGATGGTCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044704    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004174.1-1507s1c1
Sequence:CCGGGCACAATTATCTCAGAGACAACTCGAGTTGTCTCTGAGATAATTGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004174.1-2260s1c1
Sequence:CCGGAGGAATTGACAACCCTGTGTTCTCGAGAACACAGGGTTGTCAATTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004174.1-1327s1c1
Sequence:CCGGCACCACCATCATCGTAGTGTTCTCGAGAACACTACGATGATGGTGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044705    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004174.1-602s1c1
Sequence:CCGGGCCGTGTTTGAGGAGGTCCATCTCGAGATGGACCTCCTCAAACACGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004174
SLC9A3 MISSION shRNA shRNA Plasmid DNA
solute carrier family 9, subfamily A (NHE3, cation proton antiporter 3), member 3
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000044703    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004174.1-1048s1c1
Sequence:CCGGCGAGACCATCATCTTCATGTTCTCGAGAACATGAAGATGATGGTCTCGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000044704    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004174.1-1507s1c1
Sequence:CCGGGCACAATTATCTCAGAGACAACTCGAGTTGTCTCTGAGATAATTGTGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000044706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004174.1-2260s1c1
Sequence:CCGGAGGAATTGACAACCCTGTGTTCTCGAGAACACAGGGTTGTCAATTCCTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000044707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004174.1-1327s1c1
Sequence:CCGGCACCACCATCATCGTAGTGTTCTCGAGAACACTACGATGATGGTGGTGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000044705    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004174.1-602s1c1
Sequence:CCGGGCCGTGTTTGAGGAGGTCCATCTCGAGATGGACCTCCTCAAACACGGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004174
SLC9A3 MISSION shRNA Lentiviral Transduction Particles
solute carrier family 9, subfamily A (NHE3, cation proton antiporter 3), member 3
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000044703    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004174.1-1048s1c1
Sequence:CCGGCGAGACCATCATCTTCATGTTCTCGAGAACATGAAGATGATGGTCTCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044704    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004174.1-1507s1c1
Sequence:CCGGGCACAATTATCTCAGAGACAACTCGAGTTGTCTCTGAGATAATTGTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004174.1-2260s1c1
Sequence:CCGGAGGAATTGACAACCCTGTGTTCTCGAGAACACAGGGTTGTCAATTCCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004174.1-1327s1c1
Sequence:CCGGCACCACCATCATCGTAGTGTTCTCGAGAACACTACGATGATGGTGGTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044705    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004174.1-602s1c1
Sequence:CCGGGCCGTGTTTGAGGAGGTCCATCTCGAGATGGACCTCCTCAAACACGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)