EMAIL THIS PAGE TO A FRIEND

SLC9A3R1

solute carrier family 9, subfamily A (NHE3, cation proton antiporter 3), member 3 regulator 1

95 Gene Product Result for
Synonyms: EBP50 NHERF NHERF-1 NHERF1 NPHLOP2
UniProtKB ID: O14745, O43552, Q86WQ5
Gene ID:
Human(9368) Summary: This gene encodes a sodium/hydrogen exchanger regulatory cofactor. The protein interacts with and regulates various proteins including the cystic fibrosis transmembrane conductance regulator and G-protein coupled receptors such as the beta2-adrenergic receptor and the parathyroid hormone 1 receptor. The protein also interacts with proteins that function as linkers between integral membrane and cytoskeletal proteins. The protein localizes to actin-rich structures including membrane ruffles, microvilli, and filopodia. Mutations in this gene result in hypophosphatemic nephrolithiasis/osteoporosis type 2, and loss of heterozygosity of this gene is implicated in breast cancer.[provided by RefSeq, Sep 2009]
Mouse(26941) solute carrier family 9 (sodium/hydrogen exchanger), member 3 regulator 1
Rat(59114) solute carrier family 9, subfamily A (NHE3, cation proton antiporter 3), member 3 regulator 1
Zebrafish(327272) solute carrier family 9 (sodium/hydrogen exchanger), member 3 regulator 1
dog(483299) solute carrier family 9, subfamily A (NHE3, cation proton antiporter 3), member 3 regulator 1
domestic cat(101091236) solute carrier family 9, subfamily A (NHE3, cation proton antiporter 3), member 3 regulator 1
chicken(422108) solute carrier family 9, subfamily A (NHE3, cation proton antiporter 3), member 3 regulator 1
cow(505242) solute carrier family 9 (sodium/hydrogen exchanger), member 3 regulator 1
sheep(780527) solute carrier family 9, subfamily A (NHE3, cation proton antiporter 3), member 3 regulator 1
naked mole-rat(101697195) solute carrier family 9, subfamily A (NHE3, cation proton antiporter 3), member 3 regulator 1
Domestic Rabbit(100009196) solute carrier family 9, subfamily A (NHE3, cation proton antiporter 3), member 3 regulator 1
domestic guinea pig(100724451) solute carrier family 9, subfamily A (NHE3, cation proton antiporter 3), member 3 regulator 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004252 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004252 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004252 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_012030 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_012030 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_012030 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004252 Rosetta Predictions human pricing
NM_021594 Rosetta Predictions rat pricing
NM_012030 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004252 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00187915 predicted 899
2 SASI_Hs01_00187916 predicted 702
3 SASI_Hs02_00337193 predicted 1238
4 SASI_Hs01_00187917 predicted 1425
5 SASI_Hs01_00187918 predicted 914
6 SASI_Hs01_00187919 predicted 989
7 SASI_Hs01_00187920 predicted 1231
8 SASI_Hs01_00187921 predicted 649
9 SASI_Hs01_00187922 predicted 1391
10 SASI_Hs01_00187924 predicted 1211
11 SASI_Hs01_00187923 predicted 1423
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021594 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00037778 predicted 939
2 SASI_Rn01_00037779 predicted 875
3 SASI_Rn01_00037780 predicted 1216
4 SASI_Rn01_00037781 predicted 969
5 SASI_Rn01_00037782 predicted 756
6 SASI_Rn01_00037783 predicted 711
7 SASI_Rn01_00037784 predicted 756
8 SASI_Rn01_00037785 predicted 1210
9 SASI_Rn01_00037786 predicted 926
10 SASI_Rn02_00262634 predicted 1027
11 SASI_Rn01_00037787 predicted 589
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012030 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00129964 predicted 1146
2 SASI_Mm01_00129965 predicted 657
3 SASI_Mm01_00129966 predicted 755
4 SASI_Mm01_00129967 predicted 288
5 SASI_Mm01_00129968 predicted 1042
6 SASI_Mm01_00129969 predicted 693
7 SASI_Mm01_00129970 predicted 773
8 SASI_Mm01_00129971 predicted 1043
9 SASI_Mm01_00129972 predicted 816
10 SASI_Mm01_00129973 predicted 1328
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004252
SLC9A3R1 MISSION shRNA Bacterial Glycerol Stock
solute carrier family 9, subfamily A (NHE3, cation proton antiporter 3), member 3 regulator 1
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000043733    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004252.1-926s1c1
Sequence:CCGGCTTCAAGAAATGCAGAGTGATCTCGAGATCACTCTGCATTTCTTGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043734    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004252.1-1005s1c1
Sequence:CCGGCAGAAGGAGAACAGTCGTGAACTCGAGTTCACGACTGTTCTCCTTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043735    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004252.1-908s1c1
Sequence:CCGGCAGGGAAACTGACGAGTTCTTCTCGAGAAGAACTCGTCAGTTTCCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043737    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004252.1-305s1c1
Sequence:CCGGGAAGGGCAAGTTGGGCCAGTACTCGAGTACTGGCCCAACTTGCCCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000440444    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004252.3-811s21c1
Sequence:CCGGGGATCGCATTGTGGAGGTGAACTCGAGTTCACCTCCACAATGCGATCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437164    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004252.3-1700s21c1
Sequence:CCGGAGTGGACAGGGCATCTGTTACCTCGAGGTAACAGATGCCCTGTCCACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004252
SLC9A3R1 MISSION shRNA shRNA Plasmid DNA
solute carrier family 9, subfamily A (NHE3, cation proton antiporter 3), member 3 regulator 1
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000043733    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004252.1-926s1c1
Sequence:CCGGCTTCAAGAAATGCAGAGTGATCTCGAGATCACTCTGCATTTCTTGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043734    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004252.1-1005s1c1
Sequence:CCGGCAGAAGGAGAACAGTCGTGAACTCGAGTTCACGACTGTTCTCCTTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043735    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004252.1-908s1c1
Sequence:CCGGCAGGGAAACTGACGAGTTCTTCTCGAGAAGAACTCGTCAGTTTCCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043737    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004252.1-305s1c1
Sequence:CCGGGAAGGGCAAGTTGGGCCAGTACTCGAGTACTGGCCCAACTTGCCCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000440444    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004252.3-811s21c1
Sequence:CCGGGGATCGCATTGTGGAGGTGAACTCGAGTTCACCTCCACAATGCGATCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437164    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004252.3-1700s21c1
Sequence:CCGGAGTGGACAGGGCATCTGTTACCTCGAGGTAACAGATGCCCTGTCCACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004252
SLC9A3R1 MISSION shRNA Lentiviral Transduction Particles
solute carrier family 9, subfamily A (NHE3, cation proton antiporter 3), member 3 regulator 1
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000043733    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004252.1-926s1c1
Sequence:CCGGCTTCAAGAAATGCAGAGTGATCTCGAGATCACTCTGCATTTCTTGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043734    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004252.1-1005s1c1
Sequence:CCGGCAGAAGGAGAACAGTCGTGAACTCGAGTTCACGACTGTTCTCCTTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043735    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004252.1-908s1c1
Sequence:CCGGCAGGGAAACTGACGAGTTCTTCTCGAGAAGAACTCGTCAGTTTCCCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043737    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004252.1-305s1c1
Sequence:CCGGGAAGGGCAAGTTGGGCCAGTACTCGAGTACTGGCCCAACTTGCCCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000440444    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004252.3-811s21c1
Sequence:CCGGGGATCGCATTGTGGAGGTGAACTCGAGTTCACCTCCACAATGCGATCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437164    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004252.3-1700s21c1
Sequence:CCGGAGTGGACAGGGCATCTGTTACCTCGAGGTAACAGATGCCCTGTCCACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012030
VALIDATED
SLC9A3R1 MISSION shRNA Bacterial Glycerol Stock
solute carrier family 9, subfamily A (NHE3, cation proton antiporter 3), member 3 regulator 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000068584    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_012030.1-894s1c1
Sequence:CCGGCCCTTCAGCAATGGAGAGATACTCGAGTATCTCTCCATTGCTGAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068583    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_012030.1-711s1c1
Sequence:CCGGGACCGAATTGTGGAGGTCAATCTCGAGATTGACCTCCACAATTCGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068587    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_012030.1-995s1c1
Sequence:CCGGCGATACCAGTGAGGAGCTAAACTCGAGTTTAGCTCCTCACTGGTATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068585    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_012030.1-323s1c1
Sequence:CCGGGAACGGTGAGAATGTGGAGAACTCGAGTTCTCCACATTCTCACCGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068586    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_012030.1-831s1c1
Sequence:CCGGGAGTTCTTCAAGAAGTGCAAACTCGAGTTTGCACTTCTTGAAGAACTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324138    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012030.2-879s21c1
Sequence:CCGGGAGTTCTTCAAGAAGTGCAAACTCGAGTTTGCACTTCTTGAAGAACTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324140    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012030.2-371s21c1
Sequence:CCGGGAACGGTGAGAATGTGGAGAACTCGAGTTCTCCACATTCTCACCGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324083    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012030.2-759s21c1
Sequence:CCGGGACCGAATTGTGGAGGTCAATCTCGAGATTGACCTCCACAATTCGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324139    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012030.2-942s21c1
Sequence:CCGGCCCTTCAGCAATGGAGAGATACTCGAGTATCTCTCCATTGCTGAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353837    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012030.2-1043s21c1
Sequence:CCGGCGATACCAGTGAGGAGCTAAACTCGAGTTTAGCTCCTCACTGGTATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012030
VALIDATED
SLC9A3R1 MISSION shRNA shRNA Plasmid DNA
solute carrier family 9, subfamily A (NHE3, cation proton antiporter 3), member 3 regulator 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000068584    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_012030.1-894s1c1
Sequence:CCGGCCCTTCAGCAATGGAGAGATACTCGAGTATCTCTCCATTGCTGAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068583    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_012030.1-711s1c1
Sequence:CCGGGACCGAATTGTGGAGGTCAATCTCGAGATTGACCTCCACAATTCGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068587    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_012030.1-995s1c1
Sequence:CCGGCGATACCAGTGAGGAGCTAAACTCGAGTTTAGCTCCTCACTGGTATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068585    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_012030.1-323s1c1
Sequence:CCGGGAACGGTGAGAATGTGGAGAACTCGAGTTCTCCACATTCTCACCGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068586    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_012030.1-831s1c1
Sequence:CCGGGAGTTCTTCAAGAAGTGCAAACTCGAGTTTGCACTTCTTGAAGAACTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000324138    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012030.2-879s21c1
Sequence:CCGGGAGTTCTTCAAGAAGTGCAAACTCGAGTTTGCACTTCTTGAAGAACTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000324140    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012030.2-371s21c1
Sequence:CCGGGAACGGTGAGAATGTGGAGAACTCGAGTTCTCCACATTCTCACCGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000324083    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012030.2-759s21c1
Sequence:CCGGGACCGAATTGTGGAGGTCAATCTCGAGATTGACCTCCACAATTCGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000324139    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012030.2-942s21c1
Sequence:CCGGCCCTTCAGCAATGGAGAGATACTCGAGTATCTCTCCATTGCTGAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000353837    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012030.2-1043s21c1
Sequence:CCGGCGATACCAGTGAGGAGCTAAACTCGAGTTTAGCTCCTCACTGGTATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012030
VALIDATED
SLC9A3R1 MISSION shRNA Lentiviral Transduction Particles
solute carrier family 9, subfamily A (NHE3, cation proton antiporter 3), member 3 regulator 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000068584    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_012030.1-894s1c1
Sequence:CCGGCCCTTCAGCAATGGAGAGATACTCGAGTATCTCTCCATTGCTGAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068583    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_012030.1-711s1c1
Sequence:CCGGGACCGAATTGTGGAGGTCAATCTCGAGATTGACCTCCACAATTCGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068587    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_012030.1-995s1c1
Sequence:CCGGCGATACCAGTGAGGAGCTAAACTCGAGTTTAGCTCCTCACTGGTATCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068585    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_012030.1-323s1c1
Sequence:CCGGGAACGGTGAGAATGTGGAGAACTCGAGTTCTCCACATTCTCACCGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068586    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_012030.1-831s1c1
Sequence:CCGGGAGTTCTTCAAGAAGTGCAAACTCGAGTTTGCACTTCTTGAAGAACTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324138    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012030.2-879s21c1
Sequence:CCGGGAGTTCTTCAAGAAGTGCAAACTCGAGTTTGCACTTCTTGAAGAACTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324140    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012030.2-371s21c1
Sequence:CCGGGAACGGTGAGAATGTGGAGAACTCGAGTTCTCCACATTCTCACCGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324083    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012030.2-759s21c1
Sequence:CCGGGACCGAATTGTGGAGGTCAATCTCGAGATTGACCTCCACAATTCGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324139    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012030.2-942s21c1
Sequence:CCGGCCCTTCAGCAATGGAGAGATACTCGAGTATCTCTCCATTGCTGAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353837    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012030.2-1043s21c1
Sequence:CCGGCGATACCAGTGAGGAGCTAAACTCGAGTTTAGCTCCTCACTGGTATCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)